Pongo_pygmaeus Locus HSP7C_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus HSP7C_PONPY
Pongo_pygmaeus
HSP7C_PONPY
11
SNORD14, SNORD14, SNORD14
3746..3833, 4176..4262, 4974..5058
6628
CTGCCTCCCAACAGCTGCCGTAGCGAAGTGCCGGTACTGGGGGGGCCTGCGGAGCTAAC
CCGCCCCACCCCGCGGCGGCCTGGCGGCTCCCTCCAATCCCAATCCTGGGGGGCCGTGAG
CGAGCAGCCCTAGTACACCCTGAAGCCAGACCTTCGCCCCAGCCCCTCGGGGTCAGCCCT
TGCCCAAAGCCACGCTATGAATATAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCCTCCCCCGCCCGGGTAACTGAGGACTCCCGCGCGCGGGCTCTCTGCGCCCCACCCT
CCCTTTCCCGGGCCGTCCGGAGAGCGGGGCGAGCTTGAAAGTTCCAGAACGCTGCGGTGA
GTGCGTTATCGCGAGGCGGAGCGCGGTGGGGTGGGTGCGGAAGGGGGCGAGGCCCGAGGA
GTGGAGCTGGGCTTGTGATTGGGTCTTGTAAGGACAGCCGGGCGTCTATTGGCCGGGGAA
GCCGTAATGGCAGGTAGCAGGGGCGGGCCCCTTCTGGAAGGTTCTGAGATAGGGTATAAG
AGGCAGGGTGGCGGGCGGAAACCGGTCTCATTGAACTCGCCTGCATCTCTTGGGGGATTT
TTGTGGCTCTCTTCGTTATTGGAGCCAGGCCTACACGTCAGGTAAAACCTCTGCTCAAGA
GTTGGGTTGTGGGTCTGGGAGCGTAAAGCTTCCACACAGGCCGGTTGGGCTTGCTGAGGC
TTGGAGCGTTCTGAGAATTTCGTCGAGGCGAGTGTGCGGCCCCTTCCACCGGATTAAGGG
GCCTCAGTTTTCGGTGGGATGGCAGCGGCGTTTGGTTGCAGCTGGCAGGACAGAAATGTA
GGGGAGTGGGCCGCAGTGGCCTCAGAGGAGGCTGGGAGACGCCCGGCGACCGCGTGGCGG
GGGAGGGTTGCTGCATCGGCTTGCCTGGCGCGCAGGGAAATGGAGCCAGCATTTTCTTTC
ACCTGGTTCTTTGCTTAACCTAGTCCTACCGTGGTTCTTCAAACCCGTTGTTGGCGTGCT
TCCAGTATGGGGGTACGTTCCGGAGTAGTTAAAAGCCCGTTGACTCCAGGGGGCACTGGC
GCCTGGCGAGGGAGGGGAACAGATAGTGCTCAGTTCAGGGTTAAGACCACGTGTTTAGCA
ACGCTCCAGGCCCTCTGGATAGATGGGTCCTTCATTTAGGGCGTGCTCTGCTGTGGTTGG
CACGGCAACCTGGACTGCACCACTAGTTTTGGACCTCCCGCGTGCTCAGACAAGAGGTGA
TGGGCACTATTACCTCTTGACAGTGGCCATACTTTTTTCCTGGTTATGTTTTGTTTTAAG
GGATAAGGGAAATATTTTGATTAATTGAATTTTTAAACTGGATTTTTTTTTTTCAGCAAC
CATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGT
TTTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAG
CTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGC
AATGAACCCCACCAACACAGTTTTTGGTGAGTTACTAATTTTAAATGACAGAACAAATTT
AACAGGGCTAGGAAGCAGAAAAGTTTATGAAACGTGAGCGGGTATCTTTTTGTTTTTAGA
AAAACTGAGCTGAGACTTGTTCTCAAGTCTGTTATAAAACAGGTTGTAGAAACCTTTCAA
GCTGAAATCTAGGTAATGTAGGAGGTCGAAGTTTGAACCTTCACTACGTATATGGTAGTT
GAATTCACCTACCTATGAACTCTTAGTTATTTGAGTAATCATGGACTTGGGTTTTATCAG
AAGAGGTATGAAATTAAGTGTGTTCATTTGATATCTTTTATAGATGCCAAACGTCTGATT
GGACGCAGATTTGATGACGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTCATGGTG
GTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTC
TATCCAGAGGAGGTATCCTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTAC
CTTGGGAAGGTGAGGTTTGTTTTTCAGTATGGAGTGCATTCCGGAGTAGTTAAAAGCTTG
ATGACTCCCAGGGGCACTGGCACCTGGCGAGGGAGGGGAACAGATGGGGCTCAGCTCAGG
GTTAAGACCACGTGCCCAACAATGCCCCAGGCTCTCTAGGTAGATGGGTCTGTCAACGCC
AGAAACCAGTGGATCCTGACAATTACACAGTGATTTACATTTTGAGGGGGTGCTCCAGCT
GTTCTTTCACCAGCATTTAATCCATTTGTTGGAGTTTGCATATATAAGTATACTAGTTAT
CAATCTGTGGTCTTTTCTTTTTTCCTAGACTGTTACCAATGCTGTGGTCACAGTGCCAGC
TTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAA
TGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCTATTGCTTACGGCTTAGACAAAAA
GGTATGTACCATTTGTGATGCAAATCCAGATTATTTTAAGATTAATTTGATCCATCACGA
ATTTAAATGATTGTTTTTAATGGCAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACC
TGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCA
AGTCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACC
ATTTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTG
TAAGACGTCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGG
CCAGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTG
CCCGATTTGAAGAATTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAG
CCCTTCGAGATGCCAAATTGGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTT
CTACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTTTTCAATGGAAAAGAACTGA
ATAAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGGTAACAATGGTATCTCAA
CCCTAAAGGCAGGCAGGCCCAAGGTGACTCACTGATGAGTGATTGTTAAACATTCGTAGT
TGCCACCAAAAGCTTGGCTAATGATGGCAACGCCTTCCTTGGATGTCTGAGCGAGTGATA
TAGTTGTTAAAACAGGAGCTATGTACCGGGTTTTCTTTTTAGTTTTTTTTAATGTTAACT
TTTTGTTTGCTAGCTGTCCAGGCAGCCATCTTGTCTGGAGACAAGTCTGAGAATGTTCAA
GATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTGCTGGTGGAGTC
ATGACCGTCCTCATCAAGCGTAATACCACCATTCCTACCAAGCAGACGCAGACCTTCACT
ACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGGTATGTTTCTGTACTTTTGTTTGG
CTTACTGAAAACAGATAAAGGGAAGTCTTGACTGACTCGCTATGATGATGGATTCCAAAA
CCATTCGTAGTTTCCACCAGAAAGTCTCATGTTGGCCAGTTCCTTCCTTGGATGTCTGAG
CGACCATTCTTCCTTAGCAGGACTCTAGCACTATGACAGAGACCTGAAGTCCATTGCAGT
AATTCGTTTTATTCCCTACCAAGGTTTATGAAGGCGAGCGTGCCATGACCAAGGATAACA
ACCTGCTTGGCAAGTTTGAACTCACGGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGA
TTGAAGTCACTTTTGACATTGATGCCAATGGTATCCTCAATGTCTCTGCTGTGGACAAGA
GTACAGGAAAAGAGAATAAGATTACTATCACTAATGACAAGGGTAAGTAGGCACGATCAT
CTGGTCTTGACAGGGATCATAATGGTATTTCAGTTGAGTTACTGGTGCCTAAGGGCATCT
AGCTAAGAGAAACTAGAGTTACACAGGTAATTCTTTTCTAGGCCGTTTGAGCAAGGAAGA
CATTGAACGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGA
CAAGGTGTCATCCAAGAATTCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGA
AGATGAGAAACTTCAAGGCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTG
TAATGAAATTATCAACTGGCTTGATAAGAATCAGGTTTGTGATTTTTTTTTTTTTCACTC
TGTGTAGGGGAAGGGGGATGGTAAACCAAGTTTGAGTTGGATTTCAGTATAGGGTCACAA
TGATGAATGGTCCAAAACATTCGCGGTTTCCACCAGAATTCAAGGTGTTGGCAACTACCT
TCCTTGGATGTCTGAGTGACCCAAGATGTTAAGGAAGAATAAGGCCCTATTTTAACGTTG
CCAGTTTGCGCCAGACTTTTTAGTATCAGATTGCATCAGGGAGAAAGAAGGGTTATTAAC
ATTAAAAGAACTTGTAGTAATTCCTTTTTCTCTTCCTCAGACTGCTGAGAAGGAGGAATT
TGAACATCAACAGAAAGAGCTGGAGAAAGTTTGCAACCCCATCATCACCAAGCTGTACCA
GAGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTCCCTGGTGGTGGAGCTCCTCC
CTCTGGTGGTGCTTCCTCGGGGCCCACCATTGAAGAGGTTGATTAAGCCAACCAAGTGTA
GATGTAGCATTGTTCCACACATCTAAAACATTTGAAGGACCTAAATTCGTAGGAAATTCT
GTGGCAGTTTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGCATTTTCAATACTTGAA
TATGGAACATATGCACAGGGGAAGGAAATAACATTGCACTTTATAAACTGTATTGTAAGT
GGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACCATACAATTGTTCTGAGT
CTTTAAATAGCCTTCCAGGCCAGCTGGTGGGAGAAGTAGGGCTTAGGGTGATTATGTGAA
TCTTACTAACTTCCTCCCTTCCTCTTAAGCTTGAGTTAACAAGGGCTGGGTGGCAAGTTG
CCCTTCAGAGCGTTGTGGATGGTACGTTTTGGAATTCAGAGCTTTGAGAAGGGGACCATG
AGAAATGGGATCTGGATCAAACTAACCTTAGTCCTTAGTCTGGAGAGGCAGAAAGCTGAC
TTAATGGTGTTTCCTAAACTTATTCTGTGTGTAAGCCTGCCTAGGAGCAGAGGCTTTCCT
GGAGGGTTGTGCTAGATGAGTAAGAATTTAGAGATCAGAACCAAATAAAGGGCAGTGAAT
GTTAAGCTACATGGCAGGGGTATTTTTGAATCTCAATCCCTTGTATGAGCCACTGCCCTG
TGGGCTTCTATTTCATTTTCCTGAGTTAAGATTATTCAGAAGGTTGGGGATGGAGCTAAG
CTGCCACCTGGTTAATTAAGGTCCCAACAGTGAGCTGTGATAGCCTAGGGGAGCAGGCTG
TTAGCTGTCATTACATAGGTGACAGATTTCAGATTTAGGTGGACTGGCTAATCTTAGCAT
ATGCCAAAAAGCTAATTCATGAAGGAGCTTCAGTATTTCCCTTTGGTACTGAAGGTCTAC
TAATGTCTGGGTATCAGTGGGAATTTATAGCACGATTTAATACATTTCTCATTCCATATT
TTCTCCAAGGTTACAAAAAATGGCTAGTACACACTTCTTTTTTGAAGGGTTTTGCTCTTA
TTTCCTAGGCTATAGTGCAATAGCACGATCTCATTGGATCTCAGAGTGCAATAGTGCAAC
CCCTGTCTCCCGGGTTCAAGGGATTCTCCTGCCTGCCTCAAGTCTCCCGAGTATCTGGGA
TTACAGCCGTGCGCCACCACTCCTGGCTAATTTGTATTTTTTAGTAGAGATGGGATTTCT
CCATGTTGGTCAGGCTGGTCTCCCAACCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1120, 1856..2065, 2383..2588, 2908..3060, 3146..3701, 3913..4115, 4343..4541, 4661..4893, 5200..5628
1861..2065, 2383..2588, 2908..3060, 3146..3701, 3913..4115, 4343..4541, 4661..4893, 5200..5382
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved