Pongo_pygmaeus Locus RPS13
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPS13
Pongo_pygmaeus
RPS13
11
SNORD14, SNORD14
2668..2757, 3771..3861
5082
GGTGGTGCATGCCTGTGATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTTGAA
CCCGGGAGGCGGAGGTTGCGGCGAGCCGAGATCGCGCCATTGCACTCCAGCCTGGGAATC
TGGGAATCAAGAGCGAAACCCCGTCTCAAAAAAAAAAAAAAAAAAAAGCTTCTTCCTTGA
CGGTTCCCTTTTCCCAGGAAATTCAAATGCCTCATTTTATCCCTCATCCTCTTGGCCTTT
GCAATCTTGCTCCCAAGGCTCTTCCCTGCCCGCCAACTCTCTCACTTAGGAACACAGCTC
CATGAGCCTCTGCCCAACCCTTCTCCCCGGCGAGCCCAGCGCCCCAGAGCCCTGCGCAGA
GGAATTCGAGTGCGGAGGGCGGCAGGCATCCGCGGGGACCTGGTTCAACTCCTTAGACCG
GTTCTTCACCGTCAGTGACTCTCCCCTGACAGATTAGGGTAGGATTTAGAAATGAGAAAT
GGAAGCGCTGGCTGGGCGGTAGCCGCTGCCATGGCTTCCCGTGTGGTCCTCATCACATGC
TATTGTATCTGTTAATTTATTAGGCTCAGGGCGGACTCTGAGGGATCTAGTGCCAGGACA
AAGCCAGGCACTGGTGAATGAGCCAACACCTGTGTATGGCTGCTTCTTCCAGCCCTACCT
GCTCCATACCCACCCCCAGCGCAGCATTTGAATCTTTATGCCCTCGGCGTCCGCAGGGAA
TTTCGACGCAAGCTGGCGTCAACCTCAAATTCCCGCTCTGGCCACAAGGCTGACCAAAGA
CCGATGCATGCTGGGATGAGGCCCGGCCGATGACGAATCTCTTGCGACGCTGAAATGCAT
TTCGGGAGATGTAGTCACACAGACCGGCGGTGGCTGCGCAGCGTAGCTCCGCCTCCTGCG
TGCGAGGAAGCGGGAACGTGTGAGGTCACTTCCTGCGTGTTGGGTGGCTTCCTGCGGCGT
TTCCACGCTCGCTCTCCTTTCGTTGCCTGACCGCCGCCATCATGGGTCGTATGCATGCTC
CCGGGTGAGCTCGGGGCATCAAGCCGGATTGCTGGGCGCGGGGTGGAAGGAAGAGAGGGA
GTGTGGGCAGCGGGCCGAGGGGATGATGTTCTGGGCTGGTCTGGCACGAGCCGCCATCTC
ACCTCGAGACTGCTTCTCTCCCCAGGAAGGGCCTGTCCCAGTCGGCTTTACCCTATCGAC
GCAGCGTCCCCACTGTAAGTAACGCGCTGGGACCGGGGAGAATCCGGGGAGGGGGGTGGC
ATTTGTCTCGGGTGAAGCGACGCCAGGGTGAGGAACTTGCGTGTATGAGGAGCGCGGTTT
TGCGGAAGGAGAGGCCGCTGTTCTTCGGCGCCATTCCTGGGTTCTCATCCTAAGGCTGCT
TTCTATTCCATAACAGTGGTTGAAGTTGACATCTGACGACGTGAAGGAGCAGATTTACAA
ACTGGCCAAGAAGGGCCTGACTCCTTCACAGATCGGTGAGTGTTTGTGTCTAATATAGCC
TCCTTCGCCTGTCCTCGTGTGACTTGTAGGATCTAGTAGATGGTAAAGTTATTTTTAAAA
TAGCCAAAACTATGGTTTCGGCACCGTGCTAGAGGCATCATTGTAAGCACTTCACGTGTA
CTGATTTCGTTTAATTCTGACCACAATACTTTGAAATAAATCTTCGTGGCTTTCTCCCCA
GTTTATAGTTGAGGAAACAGAGGCACAGTGCAGCTGGATACTAACCATCCCCAAATCACA
CAGCTGTCAAGTGGAGGAGTTGGAATTGGCTAAGCAGAGTGCCTGACACAGTTTCTCACA
GTTAGGTGTGGTTTGAATCTCAGGTGCGTGTGACTTCGTGCAAGTGGCTTCATTCAGCAA
ATGTTTGCCTTCTATGTGCTGAACATGGTTCTAGGGCCTGAGAATATACTAGCCTCCTAC
TCCTCCGCCCAAAAAAGCCAGCCGCAATGTGCCTGTAGTCCCAGATACTCGGGATGCAGA
GGTGGGACGCTCACCTGAGCCCAGAAGTCCCAGGCTGCAGTGAGCTATGATGAAGCCACT
GCACTCCTGGGTGACAGAGAGACCCCACCTCTTTTCTTTTTTTTTTTTTTTTGAGACAAT
CTCGCTCTTGTTGCCCAGCCTGGAGTGCAGTGGCGCGATCTCAGCTCACTGCAACCTCCA
CCTCCTGGATTCAAGCGATTCCCCTGCCTCAGCCTCCCGAATAGGTGGGATTACAGGCGC
CCGCCAGCAGGCCCAGCTAATTTGTGTGTTTTTGTTTTTGTTTGAGACCGATTCTCACTT
TGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACTGCAACCTCCGCCTCCTGG
GTTCAAGCAACCAATTCTCCTGCCTCTGCCTCCGGAGTAGCTGAGACTACAGGCCGCACC
ACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGACGAGGTTTCACCATGTTGGCCAGG
CTGGTCTCAGACTCCTGACCTCAGGTGATCCACCGCCTCGGCCTCCCAAAGTGCTGGGAT
ATGTCATAGATTGTAAGTAGTCAGAGCTCATTAGAGGTTTAAAAGAAATAACGTGTAAAG
TTTTGAGAAGAATGTCTGACCAGAGTTCTCAATAAATGTTAGCTGTGGAATCTCATTAAT
TCCTTTGGTCATCTGTATTCCAGCAAGCTCACTGTGATGATGGTTTTCCAACATTCGCAG
TTTCCACCAGAAAGGTTTTCCTTAGTGTTGGGTAAACCTTCCTTGGATGTCTGAGTGAGC
TTTATGTGCATTCTCATGTTGGTTTCTGTGATGTATAAAAGTATACCCCCATCTTACAGA
TAGGAAACTGTGCCCTGATTTCTGAGCCTCGACATCATCACATTCTCCAGTTTGTGTTTC
GTGTTGAAAGTTAAAACGTGATTCCCTTTTCAGGTGTAATCCTGAGAGATTCACATGGTG
TTGCACAAGTACGTTTTGTGACAGGCAATAAAATTTTAAGAATTCTTAAGTCTAAGGGAC
TTGCTCCTGATCTTCCTGAAGATCTGTACCATTTAATTAAGAAGGCAGTTGCTGTTCGAA
AGCATCTTGAGAGGAACAGAAAGGTAAGCTAATAAATAAAACCTGGTGCTAAATAGGACT
GCTTGTACTAAATTTTTTCGGTAAAATGTAATGCATCTGGTTTGAATTATCCAAGGTGGC
TTAGTACACAAACTAGTGTAGTGCTGCTTTGAAGTTCAAATTCTATCCAAAGAGATTTTC
ATTAGAGAAAGTGCATGGTAGCTCTACATTCTCTTATTAAATTAATGTTTGATAATGTGA
AGTCATTTTGGGTGGTTTTCTTGAATTGCACCAAATTTTATTTTTAGGATAAGGATGCTA
AATTCCGTCTGATTCTGATAGAGAGCCGGATTCACCGTTTGGCTCGATATTATAAGACCA
AGCGAGTCCTCCCTCCCAATTGGAAATAGTAAGTATCAGCTCTTTTGTTGTTGTTATCAG
GAATAGGAGGCAGCCAGTAGTAAAAGTCCTAGTAGTAAATATGTTCAGCCTTGGGGGCTA
TTTGGTTAACTGCTCTTTGAGCTCTGGCCTGGTAGTGGGAAAGCAGCCACAGGCAATACA
TAATCGAATGGGTGTGGCTGCTTGTCTTTAATAAAGACAAGCAGAGGGCCATAGTTGCAG
ACCCCAGATTTAGACCATGAATAAGCCCTTTGAGTCTCTTTTAGGTAGTAGGTAGATTTT
CCTTTCATACCTCTACTCCCAGGAGTTTGAATTAATTTTCGCATGAATTGCTCACTATGA
TGATTGATTGCCAGACATTCGCAGTTTCCACCAGAAACGTTTTTCCTCATGTTGGCCAGT
TCTTCCTTGGATGTCTGAGTGAGCATCTTCATTCATTGTGCTTGAACACAATGAGTTGGT
TCAGGTATTCAGTAGTTTGGTGCACTTTATATAGTTTGGATTTATTAACTGTTTGAGAAT
AGCACCATTAGTGGGGAGATTCTGTTAATGAATGTGAAGGGACCAGTATTAATCCTGATT
TTCTTTCTTTCCCCTTTTTTCTTTTTCAGTGAATCATCTACAGCCTCTGCCCTGGTCGCA
TAAATTTGTCTGTGTACTCAAGCAATAAAGTGATTGTTTAACTAAAAGCATGTTTCATAT
TTATTTTCCTAGAAGAAAAATGTATATATATCAGTGGTTCATATGTGTTGATCTTGTTTG
ATGGGGAAGTGTTTTAGGTGATTGATGTTAGGATTCCAGGGAGCAGTAAGATAAGTGTCC
ATCACATCCCTTGATTGGCCCCTTAAACCAGTTGAGCAGCTTACAACCTCATAGGTGGTT
GCTTTAAACATGGAGAACTGGAAGACACTAGGAAATAATGCCTTTGTGTTTGTTTTGGTG
TCATGGCAAAAATGTTTCTAAGTATTTTTGATACATTTAATGTTAAAGACTGAGATAGAT
CCCTGGCAGATGTTAACCACTTGTAGCATCAGAAATAGTAATATTAGGTTGGTGCAAAAG
TAATTGTGGTTTTTGCCATTACTTTAATGCAAAAACCACATTTACTTTTGCACTAATCTA
ATACATAAAAGTGTCGAGGGAGGGGAATCTGATATGGAGAGACATTGGATCTTGTGGTGA
GGGTTAAAGATGAAGGAATCTAGGGGACAGTAAACAGGCACAGTCTGGAGCATTGGGGGT
TTAGGAAGAATATCTGAAATGGGCTTGGGTTCCTGGCCTTTGAAAATCTTTGGATGGGTT
AAGGTAAGATTTACTTGTTTTGGTATTGTGTTTTAATTTAATTCTTAACCTAATGGGGTA
AATGGGTATTGCTGCTTGAATGAGTAAAATCTCAGACAACCCTAAGGAGTGGTTCAAGGT
TATAAGACTTAGAAATGGTTAAGCTGCATGAGTGGCTGGTGTTTGTTTACAGAGCCACGA
TCCTTCAGAATTCAGAAATGGCTGCACGTGTTGGCTCACGCCTGTAATCCCCACACTTTG
GGAGGCCAAGGTGGGTGGATCACCTGAGGTCAGAAGTTCAAGACTAGCCTGGCCAACATG
GTGAAACCCTGTCATTACTAAAAATAAAAAAATAAGCTGGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1165..1213, 1396..1474, 2913..3082, 3347..3447, 4049..4082
1001..1023, 1165..1213, 1396..1474, 2913..3082, 3347..3447, 4049..4079
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved