Pongo_pygmaeus Locus RPLP2
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPLP2
Pongo_pygmaeus
RPLP2
11
SNORA52
2456..2589
4611
TGGGCCAAAGCGGCCAGCGCAGGGGCTGACCACTCGGACCTCATTCCTTCCTGGGGTGA
GCGGGCGACGCTGCCTCACGTCATTGTCCTGCCCTCCAAGGCTCGCGCTCGTCCTCTGGC
AGGACGCCCTAACACCGCAGTGCGGAGGCGGCCTCCCAGGTAGGGCCGCAGTCGCTAAGT
CCGAGGCGGCTGGCTCACCTCACTGAGCCGGGCTGGACATGGGACCACCGGTCGCCGCGG
CCAGGGAACCACCAAGGCGTCAGGGCGAACCTACCGCCAGCAGCCTCTGCCCGGGCCCAC
GTGCCGTTTCGAATAGGCCCGCGGCGCAGGCCACTTCCGGCAGCGGTGCACCATGGGACT
TGCAGTTCGCTGGCAAAGGTTGAGTCCCGGGCGTGGCGGCCGCGCCGCATGTTGGGAGCT
GCAGGCGCCGCGTGGCATGCTGGGGGCGCTAGGTACCGAAGGCAGATGTCCCGTTGGACT
CGCTTCGTCCATCGCCCCCACGAGTTTCGGGGGCCCTTCGCCCAACGCTATAAGAGCAGC
CACTTCCGGAACTACTGTCCTTCGCTTTTGCCGCGAAAACTTCCTGACAATGGCTTCTTC
CCCGTCGTCATTGGCTGAGCGCCTCGTGACGTCATTCTGAGGCGCCTCATGGGGGCGCCG
CGCTCGGGTCCCAGAGGCTTCTGGGTAGCGGTTTACCCCCGCCCCTTGCGTCGGCGCCTT
CCTTTTCCTCCCTGAGGCCGCCGAGGTCGCACGCGTGAGGCTTCGCCGCCGCCGCCGCCG
CAGACGCCGCCGCGTGAGTGCCGCCGCGTGAGTGTGGTGACCGGGCCCGGGGTGCCGACT
GGGGACGCGGAGTCCGTGGGGATGCGGGGTGGGCGGCGGGGTATTTCTGGACGGAGGCCT
ACGGGCCGAGCCACGCGCGGCCTCGCCCGGCGGCCCCGGGATGGGCTGGCAGGAGGCCGT
CGGGGTAACTCCGCCGTCGCGCCCTCTCCGCCCGCTTCAGGATGCGCTACGTCGCCTCCT
ACCTGCTGGCTGCCCTAGGGGGCAACTCCTCCCCCAGCGCTAAGGACATCAAGAAGATCT
TGGACAGCGTGGGCATCGAGGCGGACGACGACCGGCTCAACAAGGTAGCTGCCGCCTTTG
CCCCGCAGCCGCCGTGGGGCCCCAGTGTCCCATACAGGCGATTCTTCTGCCTGATTCGGC
TACATGCTGGAGGGTTCGGGGAGAGGCTAGTTTCAGTCCAGTTGGCGATTTCTTGGATAG
AGAAGTAAGCCGGGTGGAGGTCGGGCGCAGTGGCTCACGCCTGTAGTCCCAGTAATTTGG
GAGGACGAGGCAGGCGGATCACCTGAGGTCAGGGGTTCGAGACCAGCCTGGCAAACGTGT
CGAAACTCCATCTCTACTAAAAATACAAAAATTAGCCGGGCGTGGTGGTGGGTGCCTGTA
GTCCCCGCTACTTGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGATGGAGGTTG
CACTGAGCCGAGATCATGCCACTGCACTCCAGCCTGGGCGGCATAAGGAGACCCTGTCTC
AAAAGGAAAAAAAAAAAAAAAGTAAGCAGGGTGGGTACGAGGCAAAATCGTGATTAACAA
GCTTTGGAAGTTTAATACCAGTGAGATGCATAAGATTGCTTTAAAAAAAAAAAAACGGCA
GTCCTGGCGCGTGGCTCACCCAGCTTTGGGAGGCCAAGGCGGGTGGATTATTGGAGCCTT
GGAGTTCGAGACTAGTCTGGAAAACATTGCAAGACCTGGTCTCCACAAAAAAAAAAAAAA
AAAAATAGATGGAGGCAGTGGTGCACATCTGTAGTCTCAGCTACTCACGAGGCTGATGCG
GGAGAATCATTTGAGCCTGAGAGATTAAGGCTGCACTGAGTAGTGATTGTGCCACTGCAG
TCTGACAGAAACAGGCCTCGTCTCTAAAATACAATAAAAAATTAGCCAGGCGTGGGTGTT
CATGCCTGTAGTCCCAGACTGAGGTGGGAGAGTCGCTTGAGCCCAGGAGGTCAAGGCTGC
AGTGAGATCCCACCACTGCACTCCAGTCTGAAGTCAAAGTCAATTTCATTGCCAGCTTAT
TTTGCCCGTGTTGAAGATACCTATGAGTAGTCAACATAAGTAGTGAGATGCCGTGTGTCC
TTTTGTCAGTCCTAAGTCTAAGAAAGCTAGTGTCCATTTATTTTTATATCACTTCGCAAG
TGAGGCTGGTGGCTCCCTTTGGGCAGTGCAGGTCTGGAAACTTCAGGGTGTATTCCCATG
TGGGGAACCCAGTCCTGCTGTGACTCTAGAAGGGAGAGCGCCAGGGATACAGTCGTACAT
TCCTGGTAACAGCTCTGTGATTTTCTGCTTCAGGTTATCAGTGAGCTGAATGGAAAAAAC
ATTGAAGACGTCATTGCCCAGGGTGAGTTGATGTGGAGGGCTTTCGTTTGTTTCCATGGT
CCATCCTAATCCCTGCTGGTCCGTCTATGGCCTGCCAGGTTTCGCTTGTGGACCAGAGCA
CCCTAGAAGCCTCACCCGAGGAGTGAGCAGGGCTCCGGTGGGCTCACGTCATGGGCGCTT
CTAGACACTCCCAGGAGCAGGGCAGCAGGGGGCACCCTGTGTTCTCAGTGGACGTTTAGG
TGGCCCTGTCTCGTAAGCCTGGCTGCCCCTAGCCCTGAGGCCATTTCCCAGGATTTCTCT
GCAGCTTGGTGTCTGGAGAGCTGAGTTCATGTCAGCAGTTCTTACCACATGCTTTCTGTG
AAGGGGTTGGGGGCAGGGACTGAGGGTGCCAGGGATGTCCATGGGCTGCTTGCCTCTTTG
TTGGGCAGATGGTTTTTTGTTGGTGTCAGCTGAGCTGGTGGGACTTGCTTGGAAGTTGAG
CTGTTGGGGCAGCTGTTCCTGTCTTCCAGGCATGTGACCAGGACAGGGCCAGCTCAGCAG
ACAGGCCAAGCCATGAGCACATCCTTGTGGCCAGAGATGTGGACACCGGGGCAGCACACT
CATTCCCTACCTAGTTATAAACATGTCTGTCCAGTGCACGTCTGAGGGTGGAGGTGGGGA
AAGTGGGCAGGCAGGCAGTGTGGACCTAATTTCTAGAAGGCAAGTCTCTGGATAGGAAAG
GTGGGGAAGAGAAGTCCCTGTTGAGGAGTGGCTCAGGGAGGGAGTGTTCAGGAAGAACGG
GAGACACTGGCATATGGTGGGTCCAGATATGTTGGGTGCCGTGTGCCATCTCTGGTGCCA
TCTAACTTCCCTGTGGAACAGCCTCCCAGGCTGGGCAGCTGCTCTGGTCTCACCTCTCTG
CTTTCTGTAGGTATTGGCAAGCTTGCCAGTGTACCTGCCGGTGGGGCTGTAGCCGTCTCT
GCTGCCCCAGGCTCTGCAGCCCCTGCTGCTGGTTCGGCCCCTGCTGCAGGTAAGTGGTGG
CCTGGTGAGTGGGCAAGGGGCTGGGGCTCAGATGGTGTTGCTGCAGTGGGGTCTTCGTGG
GGGGACTGGCCTGGCACTTGGGCAGTGCTCACCATGCCTCTCCTCTTTTCCACAGTAGAG
GAGAAGAAAGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGACGATGACATGGGATTTGGC
CTTTTTGATTAAATTCCTGCTTCCCTGCAAATAAAGCGTTTTTACGCATCTCCAGTATTC
CATGAGCACTGTGTCAAGGGTAGCCTCTGCCCAGGTTCTCATCCCAGAGGGCAGGTGTGG
AGCTGCAGTGTGGGCAACATGGTATTGGGGAAGCGTTTCTGGTGCAAAATGAGCATGAGG
AAGGGAGTCTGGGCATCACAGCTGCCTGGTGTCCCTTCCTGTGGCTTTAAGCAGTATCCT
AGTTCCTGAGCACACTCCAGAAGAATGCGAACGGGCTGGGCACAGTAGCTCGTGCCCATT
ATCCCAGCACTTTGGGAGGCCGAGGAGAGAAGATCACTTGAGGCCAGCAGTTTGAGACCA
GCCTAGGCAAATAGCAAGACCCCATCTCTAAAAAACAACCTAACAAGGCGTGGTATGCAC
CTGTAGTCCCAACTATAAGAAGTTGAGATGGAAGGATCACTTGCCCAGGATGTTGAAGTT
AACAGTGGGCTATGATAGTGCCACTGCACTCCAGCCTGAGCAGCAGAAACCCTGTCTTGG
AAAAAAAAAAAGGACAGTAGAGAAGCTGATATATCAAATGAAGTTTGGGTAATCAGGGTT
GTCTTTGGGGTGGCTTGGTGCCTGGCCTTGCAAGGACAGGATTGGTAGCCCCTGGGCTCT
ACAAATGGATGCAGGAAGTGAGCCCAGCTTGGGGGTGGCGGACGCCCCTGGGTTTCCCTG
CAAGGGTCATGGCTCCGCCATAATGCCTTGAGCAGCTTGGGTAATCACTCCTCAGCTTGT
TTTTCTGCCGATCACAGCCCACCCCTGCCTTACTGGGCAGATAATGCTCACGGCTTGTGG
GCAGTGACCACAGGGCCATGTGCTCACTGAACTATGTCCTTTGGGGATGGGGCCTGCCCT
CCCCGACTGGCTCTGTCCTGGAATACAGGGCTTTAATGACAGATGCATCATCCTTCTCCT
CCAATCCTCTCTNNNNNNNNNNTTTTTTATTTATTTTTTTTCTTTTTGAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 2373..2421, 3310..3408, 3535..3611
1001..1123, 2373..2421, 3310..3408, 3535..3608
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved