Pongo_pygmaeus Locus IF4A2_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus IF4A2_PONPY
Pongo_pygmaeus
IF4A2_PONPY
3
SNORA63, SNORA63, SNORA4
3769..3895, 4751..4882, 5063..5203
8362
CGCAGCAAGGATATCATTGCTCTGAATTTCAATAAATCAACATTCCACTATATATCGGC
AAAGTTTACAGCCTTTAAAAAATGACCAATATAGACGGAATCAAAACCGATGTAGTCCCA
AAGCGGCACAGAGCTGTATCTGCCAAAGTGTCCATTTAAATTCGTGCGTTCCAAGGAAAA
TTACTGCTCCTTAGCTTCTACCCATTTGCAAAAGTTTATGATTTTTTCAGGCATTCCTCA
CACCTGTTAGGTTAAAATCAGTAACACTCTTAAAAAGACAGCGAGAGACCGGAAATGATA
TGAGAATAGAATTGGCCACTCCAGAGACATCTGCAAATGACATCTGCAAATCCATTTTTT
TTTCTCGCGCTGCAAAATGTACCGGTAAACCGGACTTTCTGGGACTCGCTGGGTGGCCGA
CATTTTCCCTAGCAGGAATTTTACGTTTCCAAGATCTGAATGGATGTTAACGGTCGGGCT
AAATGCCAGGCAGGTCTTCATTGTCAAATTAAACAGCGGTGGGAGCAAGCGGAATAACCG
AGTTCCCCTCCCGCACTTGAGTGCCGGCAGCGAACCGAGCCGGGACCTCTCGCCCGCGGG
AAGCCCCGGCCGCCGGACGAGCAGCACCTCCGCTTTCCGCCTCCGGTTTCCGCCTCCGGC
TCCGGCTCGGCTCCCCCGGCCCGCCTCTGCGTCAGGGCCGCGGAAACCCCGTAGGAGCAG
GGCGGGCGGGGAAAGCGAGGTTTGACTAACGCCGCAGCGATATTCTTCCGCCGCGAGGTA
AAGAGTCCCAACCTAACCCCGGGCCCTAGGATTTCCAGCGACCCTGTAATATCGAGAAAT
TACCACATTTGGATTTTCTTACCGACTTGCTTAGGATTTTATCCAAGGTAACGACCCCAG
GATCACAATTTTGTGGCTGACCGAAGCACGGCGAGAAAATTCCTCCGCAAGAAACGGGTT
CCGGCCACGAGCCTATAAAAAACGGGTGGCGGGGCGCTGCTGTCTTTTCAGTCGGGCGCT
GAGTGGTTTTTCGGATCATGTCTGGTGGCTCCGCGGATTATAACAGGTATGGCGCTCTGT
CGGCGGTCGCGGTCTGTAGTGAAGGTCATAGGGCGCCAGGGGAGATGATAGTGGATGGCA
CGGAAGCAAAAACTCTAAATTAATGGACGTTTTCTTAGGGTATAGCATCTCTGTGCCCTT
CCAGAAGCTTCCATGATGGGTAGGGCCCGGATTGTGGGGAGACAGGACGATGGTGCGAAA
GCAGTAGCTAAAGGGCGTTTTTTCCTCCCTAAGACATTACGAAACTTCGGCTGCTTCCCT
TCCCAGTGTGGAACACGGGAAACATGCAGTAAAAAGCCGTGGCGCAGTCCGCGTTCGGTA
CGGTGTTAAGCAGGACCCGAAGCTTTATTTTCGGTCTACCACACGAGTTGGGGGGTGGTC
CTAGGCTTTACTTGGGGAAGGGTTGGAGGCGGCGGTCTCCACTTGGCCACGGCGCGGAGG
CGACGGGACAGAACCGGCGCGGTGCCGGTGAACCGTTGGCATCGCCCTCGCCAGGCCGCT
CCGCCCGCGTCAATCACCCGGCTTGCGCATTGTTGGGGGCGGAGTTCGGCGCTCCTAGTT
CTCGCGAGACGGGCCGCAGCTGAAACGGGATAGCCATGCGCTCTGGCCCGGAGGGCTGCT
TTTCCGGGCATCCGCAGCCCCCAATCTTTACGGAAGGCGCACAGTGTGATACTCGCCTTG
CAGCTGCTGCTTTTAGCTTGTGCAGAGGAGGCTAACGTGCTGAGACGGGTTGCAAAGGGC
TATCCGTTTAAGGTGCAGTTGAGGTGGCTTGGAAGGGGTGTCTGACTGCACTATTCTTGT
CAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGAAA
CGGTTGTGGATCTTGAAGCTTTGGAAAGGTGAGTGTGTTCATCTCATTTATGCGTGCATT
ATTTTTTCTAACTTACAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAAT
TTAAAGGAGTCTCTTCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATT
CAGCAGAGAGCTATTATTCCCTGTATTAAAGGTAAAAGAAACTGGCATTTTTAGGAAATT
GTTGTACATAGACATGAACCATAAAAGGGAAAGTAACCTCTGGGGGACTAGCACCTGTTT
GTATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGAA
TACTCATTGCTGATCACTTGATTATTTGGGCATAATTCATGTTCCAAATGGAATACATGG
TGTGAAGTAGAAGTGACAATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAG
GGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTT
CCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCA
CCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGC
ATAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAACTTAGTATAAATTGGTCCTACCA
GATCCCTCCTTTTAATTGTCCATGCATGCAGGGAGTTTTTGTTGAAAGTTTTGAAAGAAC
TGGGTATGCAGGTATGGTTTGTAGGGTTGTATACTAATAGATTGAGAATCCGAAGCGCTC
TCTTGGATGTACTAGATCTGTCCCCATTTTTTAAGTTTGAATGCAGTTGTGCAACATGAA
AACTGCAGTGACATGTTACCATTTGACTGTCTCCGTAGTTTGTGATGCATCTGTTGCATG
CTATGTTTTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAACTTTCCTAATAAAGCTGT
AGGCTTTATTGAGGTTAGGATTATATAAGGCACAATACTTTCTGGGGGAAAAAATCATTT
GCCTTAGCTGTAATTACAGAACATAAATTTCACTACGTACTCCCTACCTACAGTGAAGAA
TAATGTAGGAAACGTTATTCTTGAATTGTCCAGCTGATGCGTGGAGCAGCAGCATCCCAA
GTTTGACAAGGCATAAGAAAGGCATTAAGGGAATTTTACCTTGCAGCAGTTAGGTCGTCT
GCATTTTAAGTTTGGAAGTAGTTTTGTGCTGTGCATGCATAAAAGCTGTTGGCAGACCAG
ATTATATTTGCCATTACGCTTTAAAAATTAGTCATTAATCTTGGAGTTCTGCAGGATAAT
AATTAAGGCTTGGTTTTTAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAG
CCACTTGTCATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGG
CTGAAGCACCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATATGTTAAACAGAA
GATACCTTTGTAAGTATTGTCTTTAAGAGAGTATGATGATGATTATTTTTTTTTCTTTTT
TACTGTTAACATAGTTGAAAAGTCAAATCGTATCACTGAGTAGATCTAGAAATGACAGTA
TGACTTTGTTTCTAACAGCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATG
AAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAAACACAA
GTATCCAGGTAAGCATTACTTCACCCCCCTTAAAGGTAGAGATGGTTTAATGCAGGTACT
GTTACAATACAACTGACGTGTTTTATTGTCGTTCCCCCTGCTTAAAGCACTTGATGCATA
ACTATCTCTGTCTAACTCCATTCCGTAGTAAGACAGAGACGCTTGGCTTCAAACATTTTC
CCTTGGGTATTACTGTGTAAGTTGTGCTACAACATAATTTTCTCTTTTTAAGGTTGTGTT
GCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCC
AATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATAT
TAATGTTGAGAGAGAGGTAACTGTCTAATTGTTAGACATTATTTTACCTTCTTGTATAAG
CACTGTGCTAAAATTGCAGACACTAGGACCATGTCTTGGTTTTTGCAATAATGCTAGCAG
AGTACACACAAGAAGAAAAGTAACAGCACTAGATTGTAAAGACTGGGGTGGACCTCTTTC
TTAATGTCCAATGTCCTTTGTCTTAAGATTTGGTGCAATATCTCATTAGACCTAACAGAA
TGAAGTTAATTTTTATAATTTCTACATTTTGAGACTGGGTTATAAGACTGGCTAAGACTG
GCCAATTTTGGTATTTTGGGTAGAGATGGTTTCACTATCTTGAAACCCTGGTCTGGTTGG
AACTCTGGGCTCAAGTGCTGGGATCCCAAAGTGCTGGGATTACAGGCATTAGCATTGTGG
CTGGCCCAGAATGAATTTTTAACTGAAGAAAGTTGGAAAAACTAAATGACTGTTAACTTT
CTCTTCTAAACATTACAGGAGTGGAAGTTGGATACACTTTGTGACTTGTACGAGACACTG
ACCATCACGCAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTGAG
AAAATGCATGCCAGAGACTTCACAGTTTCTGCTCTGGTAAGAGGTGTTTTAAAATGTCTG
AATTTCCACTAAAGCAGGATTCAGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTTC
CCCCTGCTCAAAATAAAGTTGTTTCTTAACTATACCTGTCTGCTAGTCTCCTGTAGCAGC
CAGGGACGCTTGGTCTCATACATGTTGATTAAAATTAAATACTGACCTGACTGGTGATTC
TTGAATTAAGGTTTATTAATTTGCAGCATGGTGACATGGACCAGAAGGAGAGAGATGTTA
TCATGAGGGAATTCCGGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGTAA
GTCTCTTAATGCTTTTTTAAAATCTACCAAAAGTTAGCTTTTTGGGGGGAAGGTTTTTAA
GTAACCTTTGCCAGCTTGGGCTATTTGGAAGAGTAAAAGAAGACCACACTCCACAGTGGG
CTATATCACTTAGTATAGTTCGCTACTCTTTTGTGGCCTACATGACAGGTGTCAAGTTTT
TTTGAATCAGAATTTTTAAAACATGCCATTGTGTTTCAGGCTCGCGGGATTGATGTGCAA
CAAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGG
TGAGAAGCCAGCATCTTGGCTGTATGGAAAAAATTCATACGTTTTTCTACTGTGATTTGT
ATGAAAGGTAACATCAAATCAAGGAATAGATTCAGTAAAGTCAGTAGTGTTCGGTAAGAT
GATGTAATTAAATTTGTACTAGGGAAGGTTGATGAGAACAAAGTGGGAAAACTTGTAAAC
ATTGCCCAGATTGTGGACATAGGTTTTTTTTTCCACAATTGTTGGTCTTAGCTTATGCTT
GAGCTTTTAGTGATGTTGTGTCCATGTGTTTTTCTTGGTGATTTTTTCTATAGTTGGGAT
TTTCTTGGTGTCGCTGGTAGCAATTTGAGTGAACCCTGGTTTAGTTATAGTGGCTTTATC
CCTAAATAAATTGAATTGTACTTTGTTATATGATGTAAAAAAAGACTTTTTAAAAAATAC
AGGAGTCGATAGCAGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTT
AGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTA
TATTTGTTTTTCTTTTGTCATGATTATTTGATTATTTTTAAGTTGCTCCAGCTAAGGCTT
TTTTTTTGTATTAGTATTTCTACTAGGGAACCTTTCTTATTAGGTGGTTTGTATTGTCTG
GTTTCTAACATGAAGGTAGCTGTTTGGCAGTTAAACACGTTTTGAGTAATTTGAGTTACA
ACGTGTGAAACTGAGCAAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATATTTGTT
TTCCCACTGGAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTTGCAGCATTTGTTTACAG
TTTACAGTTCCAGAAGTGCGTCGAAATGGATTACATAACTGCTCTTTGTTTTATTCCTGG
TGTTCACATCTGTCCCAGGCTGACACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTT
AATTTCACTACCCCAAACATGATACTGTCATCTGCTTTATAATAATGCTCAAGATGCCTG
ATAAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAAAGG
AAGATTTTTTTCTCTAGATATGCATTAGCAGCTAGTGCTCCAGTTTAGAAGCACGAACTA
TAACCTTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATGTTCAGTAGTT
TATACATTATGTGAGAAGTAACATTCTGATTGTTTCTTTTTCTTACACAGAATTGGCAGA
GGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGG
ATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCCATGAATGTG
GCTGACCTTATTTAATTCCTGGGATGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAAT
AGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTGAATCTTGTCTCAATGCT
CATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACATTAGTCGTGAGCTCTTGTG
AGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATG
GGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTA
TTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATA
AAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTGTCATTAGCCTGAG
TAGAAAGGCCTTTAAAATTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTAT
TTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCA
GCAAGCAATCATCCTAGGTAGGGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCT
TAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGGTGCTTTTGGTCATTT
TATTTTTATTACAACCCCATCATTTACAAAACCCCCCATCCAAATATATTCACTTTAACA
ATTTTGAGATAATTGCTGCATCACAGTTGCACAAAGGCTGATGAGTTGCAAATGTTCATC
AGCACCATCTGCTAGGCATTTGTCAACCTCCTATAAGAAAAATTTAAGAAATTAGCATCC
TTCAGGTAGTTAAATGTTCCACTGACATGTGCAAAGTACCTACTTACGGCAAGTTTTTCT
GTAATAATGGACTTCTGTTTATCAGATAAGTTATTTTCTACAACCACATCATGGAGTTGA
TTGACGAGCTGAGTTGCTGCATGACCCTCATCAATTAAATCCTATAATAAAAAAACTTTT
GGTATGATGACTTTATATTCCTTTCCCCAAAGTTAGTAAGCTGACTTTACCTTGACCACA
GCTTCTAGTTTGTCAAAAGAGCCACTCTGACAGGCAGCAAATACTCCATCAATTTTCTCA
GCTGGTATTACCTAGGTAATTGGATGTTCAGTATTAAAGATGTTTCTAGGTGAGACTAGA
CGTGCACTCTGCCAGCTGACTCCCCTGCCCCCAGTCCTTTCTGTTCCACACATAAGTTCC
ATACTTTTCTGGGAAGGCTTTGGGAGAAAGCCAGAGTAACTCCAGTCACCACTAAGCAAC
CAAGGTGCTAACAGCTGTGCTTTTAAAGCCCTTTAATGGCTTCTTTGAAGCCGTTTGGGC
ACACATGGATTATAGCTTGTTCTGGTCAGTGGATGAAGATTAAGTTTTCCCCTAGCGGCT
ATAACGATTCCTCAGAACAGTGGCCAAGATCAACCAAAAAGACTGATTTCCTTAAAGGGG
AAGTGCCCTTTCTCTAAAAATCTCTCCATGTAAAGATGCCACTAATGAGATTGGTTTAAA
AAGTCCACAATATCCAGAAAATTAAAGAGGATTAGTGATATCAGTCTTGTCATATGGAAG
GCCTACTGCGCAGATGAAAAATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 1866..1911, 1998..2130, 2400..2539, 3320..3488, 3618..3727, 3952..4095, 4578..4715, 4946..5035, 5259..5338, 6590..7362
1037..1065, 1866..1911, 1998..2130, 2400..2539, 3320..3488, 3618..3727, 3952..4095, 4578..4715, 4946..5035, 5259..5338, 6590..6731
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved