Pongo_pygmaeus Locus ENSPPYG00000013391
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus ENSPPYG00000013391
Pongo_pygmaeus
ENSPPYG00000013391
3
SNORA7
2088..2226
8308
GTCTTACTATGTTGCCTAGGCTGGTCTTGAACTCCTGGGCTCAAGCAAATCTCCCGCCT
CAGACTCCCAAAGTATTGGAATTATAGGTGTGAACCATAGTGCTCAGCCAATTTTCACAA
TAATCTTAAATACAAAAGCTAAGCAAAACAAATGAAGAGCATCTTTAAAAACTAGGCAGT
CTGGGAGGCAGGGGCTGCAGTGAGCCGTGAGATGGCACCTTTGCATTCCAGCCTAGGTGA
CAGAAGGAGACCCTGTCTAAAAAAAACCAAAAAACAAAAAACAAAACAAAACAAAAAACA
ACTAGGCAGTAGCTCGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCGAGAGGATCG
TTTGAGCCCAGAAGTTCAATACCAGCCTGGGCAACAGAGTGAGACCCCATTTCTAAAAAA
TGAACAGACAAAAACTAGGCAGTTTCGCCCAGTGGTTAGAAGCGTGGAGTTTGGAGTCAA
GTCTCCAAATTTCATCTTCCACATATGAAAAATGGAGACAATAATAGGGGTACGTTATAG
AATTGTGGTAGGCATAGTGAACTCCATCGCATGTTAGCTGTTTTCGTTACTATTTACTGT
CTAAATTCGGTGAGGAAATTATTAGGAAGTCTCTGTCTTGTTCTCTTCTGACCACTAAGA
GGCGCACTTCGGAGTAGAAGAAACGCGGGCGGAAATAGCCCAAAAGCGGATTGGCTTCAA
CTTCTGGCGGAAGTAAGTTCCTCCCTCCACCAGGTCTTATTAGCTCAGAAAGAATTCCAA
ATTTCTACGTAGTCCCAAGGACAGATAGAATACATTTTTCAGTCCTACTCCTAGTTATTG
TGGTCTATTAAAACATGTATGCTCAGAATTTTTGCGGCATTATTTTTTGACGTGTCTTTA
TTTTATTTAAAAGAGCCGGAGCCGGAAGTGCTTGCCTTTTTCCCTGCCAGGACCCAGGTG
TTACGTCCCATCAGCCCTTGCGCGCCACCGTCCCTTCTCTCTTCCTCGGCGCTGCCTACG
GAGGTGGCAGCCATCTTCTCCTCGGTAAGTGTTAATCCGTGGCAATCTGCATTCCTGCGG
GATTCATCTGGCCCCATCACCCAGTGGTGCGGAGGCCTCCCCTTCAGCGCGGTAGTGTCT
GTGGGTATTGTTATTGTCAGCTTACTGGAGCGTGTACAGGAACAGAACGAAGCAGCCGAG
TTGATAGGGCTTTGCGTCCCAGAGCCTCCTGCCCTCCGCCTGTAGTCAGAGCTGCAGGCT
GCTTGTTTGTTCCTTGGCGGTGGAGGGTGGTAGTTGAGGCCAGACTGCGGGGTCTTCTGG
GGGCCGTGGGACGACCAGGGGTGGCCCAGCTTGACAGCTTTCAGCTGGGATCTGTGGCTC
CCAGCGCTCACCGATGTCGGCCCACGTGTATTCGTTCATTGCCATGGCCCGCTTCTTCCG
CTGCAGTCTCTGGCCCGAGGGCTGCTGCTGCGGGACCGCCAAGGAAAGACGAGCTGTAGG
TCGGCTGGTTCAGTTGCAGGCAGAAATTCTGGTAGTATCTCTGGGAATGTGAAGATGCAA
CTGCCCCCACCTTGCCTTCGAGGATATCATGGGCCAGAAGGCAAAGTCGTTTTGAATACG
GTTCATTGAGTACCCACTCTGTGCCAGTTGATGGCTGTGAAGAGAACAGGAGGGGTGCTG
CTGTAGGAAATCAGTGGCTCGGAAGACCACACTGAGGAAGGTGTGAGTTGATACTGGAAG
ATCTCCAGGTTTGAGGCATCTTCAGAGGTATATGGTGGTTTTGTGTGTTGAGGGTGTGGT
AGCGCAGCAGCTCCCTAGGGAATTAGAAGGTTTTCTTTATTGAACATTTACCCTGTGACA
GGCACTGCAGGCATTCAGCGTGCAGTGTCATCTTCATTTTACAGGTGAGGAAAAGACTCA
GGTTCAAGTAGATGGTCAAGGCCAGTACTACCGGAAGGACCATCTGGGGGTTTGGACACT
GGCGGGGTGGGATTTGCTGCCCCTTGCAAATTGAGAGTGTCTTGGGGTCAGTTTTGATTT
GCTCAGCCGTTGGCATTCTTTGGGCTCTGAGTGGGTGAGATGACCCTTGACCTCCTGGGA
TCGCGTCTGGAGAGTGCCCAGTATTCTGCCAGCTTCGGAAAGGGAGGGAAAGCAAGCTTG
GCAGAGGCACCCATTCCATTCCCAGCTTGCTCCGTAGCTGGCGATTGGAAGACACTCTGC
GACAGTGTTCAGTCCCTGGGCGGGAAAGCCTCCTTCCAGGATTCTTCCTCACCTGGGGCT
GCTTCTTCCCCAAAAGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGTC
AAGAAGAGAACCAAGAAGTTCATCCGGCATCAGTCAGACCGATATGTCAAAATTAAGGTA
TGTGGTCCTGGGATGGAAATGGGTGTGGGGTGAAGAAGGGAGTTTCCAACAGGCTGCCAG
TTTCTGACATCACCTAGTCAGGATTACCTTTGACCGATGAACTGGTTTGTGGAAGAGCTT
TCTGTAGAAATACAGGTCTCCCCCAGTGTGCCCTAGTGCTGGTACTTATGTCTCTTGATG
TGTGAAGTGAAACTTTAATGAAAAGGGACCCTTGGCCGTTTTGATGTGTTTAGAGGGCTT
TGCATTTGTGTCATGTATTTTGGGTTGCCTTATGACAGCAGGATCCCTATTTTATAGACA
AGAAAACTCAGGTGCTGAGAGCAGTGTCTGAAGCTGTGCTTGCCATCTCAGTATCTACAC
AGTCCCCTCGCATCCCATTGGTGCCTCCTCCATTGCTTGGGAGTGGCAATGGCGGGGGTG
CCTGCATACCTAGTGGCTAAAGCCACGAGCTCCTAGTTTTTCCCACCAAAAAAGTAAGGA
AATAGTGAAGTCCTGTTACCAAAGGCCACTGCTGTGTGGCATACTTCCTTTTCATTTGGT
CCTTTTTTCCCCCCCCAAAAGAAAGAGTTGGCACTCTGCACAGACACTAACCCACCTGTG
TATTATTTCCTTCAGCGTAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGA
AGATTCAAGGGCCAGATCTTGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAG
CACATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTG
CTGCTGATGTGCAACAAGTGAGTTGGCTCCCACCTCTAGTTTTCAGGGATCAGAAGTTTG
CATCTATGTGAGCACTTCTGGCAGGAACTCTATAAACTCTTGGGATGCATTTTGGCCGGG
GGGTTGTACATTCTCTGAGGGAATCAGAAGTTGTTCCTTGCAGGATTTTAGAGAATGCTT
GTTGAGGAGTTCAAGGTGTTTCCTTTGCTGAAGGGAGGAGACTTGGTCTTGTAAGTGTAG
AGACCCAAGACCAGGAAAAGACTGCTTTGTGAACACTGCAATAAGAGCCACTTTCCACTA
CTACAATGTCCTTTGGCTGTTGTTTCCAAAACGTTGCTTTGTTTATGAAGGTGTCAACCA
AAAGAGTTGAACTCTGAAATATTCGAAGAGATTTATTCTGAGCCAAATATGAGTTGACCA
TGGCCCGTGACACAGCCCTTGGGAGACCCTAAGAATATGTGTCCAAGGTGGGCAGGGAGC
AGCTTGGTTTTACATATTTTAGGGAGACATGAGACATCAATCAAATACACTTAAGGCATA
CATTGGTTTGGTCCAGAAAGGTGGCACTTCGAGGTTTTGGATAGATTTTCTGTTTCTCGT
TGGGAATAGGTTATCACTAGAAAGGAATGTCTTGGCTACAGTAAGAGCTTGTGGAAACCA
AGAATGCCCTATTCAAGGAGGGAGTGCATTCAGATGGTTGCTGGGGGGCCTTTGAATTTT
ATTTTTGGCTTACAAGCGGGGGAAGGTCAAACATGGACCTCAGACCTTAAGGGGCTCTTC
AGTCTGTGCTGTGGTAAGGGGTATCTTCAGGAGCAGGAGGGCTTTAGAAAGTTTGGATTA
GATGGAGAACAGGAGGAAACTTGGCAGGCAGAGAGTGCTTACACACAAGGTGGAGAGGTG
AAAGCGCATGGAGGGTTTGCAGGGCATTGGTTCCAGGTGGGTTTTATTGGTTTTTGTTTT
TTAAGATGAAGTCTTGCTCTCTTGCCGGGGCTGGAGTGCAGTGGCATGACCTCGGCTCAC
TGCAACCTCCACCGCCCAGTTTCAAGCGTTTCTCCTGCCTCAACCTCCCAAGAGCTGGGA
TTACAGGCATGCACCACCATGCCTGGCTAATTTTTGTATTTTTAGTACAGATGAGGTTTC
ACCATGTTGGCCAGGCTGGTTTTGAACTCATGACCTTAAGCGGTCTGCCTGCCTTAGCCT
CCCAAAATGCTGGGATTACAGGCATGAGCTACTGCACCTGGCCTGGTTTGATTTGAGAGA
TAGACAGGCTCTGTGTTGCCCTGCCCTGTGCAGTGGCTATTCACAGCTGTGATCATGGCA
CACTGCAGCCCCAAACTCAAGATGGGCTCAAGCTGTCTTCCCATCTCAGCCTTCCTGGTA
GCTAGGACCACAGGCACACTCCACCACACCCAGCTAGTTCTAGGTGTTTTCAGTAAGTTA
GACACTTGGTGAGCTTTGTGTATGAGACTCAGTGACCTGCTTAGACCAAAACTAGGGCAG
TGGAATGAAAAATTCTCATGGGAAGTGACAGTTTATTTTCTTCACTTATTGGTAAATGGA
AGCCAAAAAGCTGAATTTTCCTAAGTAAACTAGAAAGAACATGGAGTGTGTGTGACTAAC
TAGGATGTTTGTGTTTACGTTTACAAAGATAACTTTCATCTACAGTGGTTGTAGATACAA
GTAATAAAAATGAACAGGACCAGTATTCTAGCATGGTTACCTTCCGAGATTGGAAATGTG
ACCAGGTGTTGAAACGCTGAAAATCGCTGTTAGAAAAGGTGGGCGAAGGAATTAATGGTG
GACACTGAAACCACAGTTGGCTGTATGAGTTGAACTATAACAGGCAATACCTGTTGTATG
GCCAACATGATTACTCAGTTGCAGTGCACATGTTGGCTGGTTGGCATATGCTCTGTAAGC
GCAGCTTGGCAGTCTTTAAGATCCATAGAAATACTCTTTGACCTTTGATCTGTTAAGTTC
CATTTCTGGGCATTTGTCCTTAAGGAATGGAAAAGCAGGCAAACTAAAGCTAGTCATTGC
AGCAATAACCCACTGGAAACAACTGAAAATATAATGAGAGAATTGTGGAGTGCTGGATAG
AATGTTGTGAGTCCATTCAAAATGACTGAAGTGTTGTAGTATGGAAAATGCCCAAGCTAG
GGGGGACACATTTAAAATGGTGGGTACACTCTGATTGTGCTTATCAAATATGTAGATGGA
CAAGGACAGGAGGGTTTTTTGAAAAGTAAAGACATGAGAAGTGTAATATAACCTAAGTCT
TTAAAACATAGAAACATTTAAAAATACAGTTGCTTTGAATTTGAGTGGACTCATATAAAA
CAAGTATTGTCTGGATTTGCTGTCTTGCTAGTAAGGCAGAGTTCTTGAAAAGAGTTGTGT
GTCCACTGCCTCAATCACTCCTCACAGTCCTGCTGCTGCTTTCTTTGCTGAAAATGCTTC
AGGGGTGGAATGTCTGTTCTTAACCACTGTGGGTGGCTTCATAAATCACCTCCTTACTGA
AGTGTGCTTGTTAGGCCTATAGGTTATCAAATGGGGCACAGTGTAGCTGCCTCTTAAAAA
GTTGTGAGGAATGAGTTAGAACTGGATCTGAAGTCCTCAGGTATTAGGCATGGCTATGAC
TGGGCGACTTTAAGCATTGTTGCTTCTCAACTTGCTTGAGTTCTGAACCTTCATGGGCAA
GGTCAAGCACCCTGCGACTGGGGGAGAACCTTTGAACCTGGAGTGTGGGCCTGGGTTCAC
CCCGATCCCTGTCCATTGCTTGCTGTGGGCCTTGGTTTCCTTATCTGTAAAATGGAGGTA
ATGCCTGGATTACAACGCTGCCATAAGGATGAGAGGGGACAGTGAGGGTACTTTGTAAAT
GAAAGCATTCTTGTCACCACCAGGGAACCATAGTCAGGATTTGGGGGATGTAGGTGTCAT
TCCACAGCCACTTACCAAGCAGCCTTCTCTTAGCTTGGTGCTGGGACTCATTGCCTCCCC
AATGGAATTTTCCAAGTGTGTTCAGGGCTGTCTTGCTCCTTACCTACTTGATTCTCTTAC
AGATCTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATCGTG
GAAAGAGCTGCCCAGCTGGCCATCAGAGTCACCAACCCCAATGCCAGGCTGCGCAGTGAA
GAAAATGAGTAGACAGCTCATGTGCACGTTTTCTGTTTAAATAAATGTAAAAACTGCCAT
CTGGCATCTTCCTTCCTTGGTTTTAAGTCTTCAGCTTCTTAGCCAACTTAGTTTGTCACA
GAGATTGTTCTTTTGCTTAAGCCCCTTTAGAATCTCCCATTTGGAGGGGATTTGTAAAGG
ACACTCGGTCCTTGAACAGGAGAACGTGGCCTCAAGTGCAGACTAGCCTTAGTCATCTCC
AGTTGAGGCTGGGTAAGAGGGGCACAGACTTGGCCCTCACACCAGGTAGGTTCTGAGACA
CTTGAAGAAGCTTGTGGCTCCCAAGCCACAAGTAGTCATTCTTAGCCTTGCTTTTGTAAA
GTTAGGTGACAAGTTATTCCATGTGATGCTTGTGAGAATTGATATGCATGGAAATATCCA
GATGAATTTCTTACACAGATTCTTATGGGATGCCTAAATTGCATCCTGTAACTTCTGTCC
AAAAAGAACAGGATGATGTACAAATTGCTCTTCCAGTTAATCCACCACGGTTATTGGAAA
AGCACTTTCAGTCTCCTATAACCTTCCCACCAGCTGCTGCTTCAGGTATAATGTTACAGC
AGTTTTGCCAAGGCGGGGACCTAACTGGTGAGAATTGAGCCTCTTGAGTGGTACTCAGAA
TTTAGTGACACGTGGTCCTGATTTTTTCTGGAGACGGGGTCTTCCTCTCACGTAGGCTGG
GAGTGCAGTGGCACACTCACTACAGCCTTGACCTCCCCAGGCTCAGGTGATCTTCCCACC
TCAGCCTTCCAAGTAGCTGGGACTACAGATGCACACCTCCACACCTGGGTAGTTTTTGAA
GTTTTTTTGTAGAGATGGTCTAGCCATGTTGCCTAGGCTCTTGAACTCCTGAGCTCAAGC
AGTCCTGCTTCAGCCTCCCAAAGTACTGGGATTACAGGCATCTTGTGTAAGCTTTTCTAG
TTCTAGTCTCATTCTAGTAGACAGGCATCTTACAGATTGTCTCCTGTTCAAAACCTAGTC
ATAAATATTTATAATACAAACTGGTCATTTTTGGGATTTTGTTTTTGAGACTCATGCTGT
CAACCCTGCTGGAGTGCAGTGGCTTGATCTTGGCTCACTGCACTTCTGCCTCCTGGGTTC
AGGCGATTCGATTAACAATTGGAGACGAGTCGTGTAGAGAAAAGTAACTTAGAATTTAAT
CTTTATTTAATCTGGGATATCACAGAAAATACTTGGGCCTGCCACTTGTATTTCTTTGTC
CTCAATACTAAACACTAGACACATTTGAAACCTTCCTCAGAAGGAAACAAACCAACTGGT
TATGCCTGGGTGGTGGCATGGAAGATGTGTACTTCCTTGTTGCCCAATTTGCTAGTAAGT
ATTTTGAAATAAACATGAGGTCCAAGCCTGTCCAGTTCCCTACCCAACCCATTCCTCCTC
CCTGGAAAAAAGAAACCCGTATCTTCCAAATTTCTGATTCATCACTGCCACTTAAAAATG
AACCGTTTTGAATTTTAAAATGTGAATAACTCAAGTATCTTTTCTTTTGGGACGCCCGGC
CTGAGCACTAACTTCAGGCATTGCTGAATGCAGTGAAGAAACCAGAGTGGTGTCTGCTGC
CTCCTGACCTTTTACAGCTGTGACAGTACAGCCTATTTCTAAATACTACTAGTTTGTGAG
GCAGAGACACCCTCTGAAGGAACTAGACAGACTATGGAGGGGTACAGTGTGAAGTCACTG
AAAATTTCCTCACCCTATTTCTTTGGATGACTGTCCTGAGTTAAGGAAGGGGCCCAACTG
TTGGCAGCCTCACAGCTTGGGCTGGGGGCCTTTGAGTTGGGTCCCTGGAGAAGGCACTGT
AAGCCCTGACCAGGAGCGGCAGGGCCCCCAGTGAAATGGTGGAAGGGCAAAAGTAGAGAC
CTGCGGTGGTGGGATGGGGAGGCCTCGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 2296..2396, 3015..3196, 6242..7308
2301..2396, 3015..3017
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved