Pongo_pygmaeus Locus TPT1
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus TPT1
Pongo_pygmaeus
TPT1
13
SNORA31
4596..4725
6301
TGTGTGTGTAGAGACAGGGTTTCAGTAGTTGCCTCCCAAAGTTCTGGGATTACAGGCAT
GAGCTACCATGCAGGACCTGTTTTGCTTTAATACCTAGTAATTAGGTGTAAAGTCCTTCA
AAAAACAGGTGGGGCAGATGGGAAACTCCCTTTGTTTGTGTGACCCTCTAGCACCAGGGA
TAAAATTTCAACTTCATCTTAAAGCGACAACATACTTTTCCAAGAGCAAGTGCGAAATAG
TAAAAGGAAGAGCCAGCTCCGTAGCCGTCCGCCACAGAATGCCACAAGCTTTCAATTATG
GGACAAAATTGGAACACATGGAAACCCTGAGCAGACTCCCGTGACATCTTCCCTCCTCTC
CAAGTCCCTTCCTACAGACCCTGCGCCCCACACGATTATTCCCCAGGGGCCGAGCAGGAC
AACTTGGGTCCCACTACTCGGACTCAGCGGTGCCCCCACAAAAGCGTCCGAAAAACTCCA
GCTGGGGCAGCCCTGAGGCAGATACTGAAAAGTTGTCAGAGGCCCTCGGGGCAGTCCCAA
GATCTCCCCCAGGCCAGAGGGCCTGACCCTCCCTAAATGCAACGTTCTTCTACATAGGTT
GATACTCAGGTTGCCAGAAAAGGGTGGAACCTAGGCTGGACGAGACGCAGGGCGAAAGTT
TAATTCCTCTTAAGCTCCACCCAGCTCCCAGCACCTCTCCAGGCGGGCCCCGTGGGGTAG
GGCGGAGCCGGGTCCAACATACTCGGCTTCTCCCGCTCTACCCACCCAGGGCTAGGGAGC
GCAAAAGAGTGTTGGCCTCCTCCCACGCTGCGCGCGCACCTCCCCGCCCACACCCCCACC
CCCACCCGCTGGCGTGCCCCGTGGAACGGAGCCTTGTGTGTCCGCGTCAAGTCCCCGGAT
GCTCACCTCCCCGACTCGCCCCCGCTGTGGCCCCGCCCCCGCGCGGCTCTTCGTGCCACG
TCACCGCCTGCGTCGCTTCCGGAGGCGCAGCGGACGATGACGTAGAGGGACGTGCCCTCT
ATATGAGGTTGGGGAGCGGCTGAGTCGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGC
GCCGCTCCGGCTGCACCGCGCTCGCTCCGAGTTTCAGGCTCGTGCTAAAGCTAGCGCCGC
CGTCGTCTCCCTTCAGTCGCCATCATGATTATCTACCGGGACCTCATCAGCCGTGAGTTC
TCACTTCACTACCCTTACTGCCGCACACGGGGATCTGGGGTGCGGGTGGGGGCGGGGAAG
GCGCAGCAGTCGCGGGCCTAGGGGACGCCGGCGGCCTCAGCCGAGCGCGGAGGGGTCGGT
GCCCGGGGCTCGCGCCCGGCTCTGGTGCTCTCGGGAGGGGCAGATGCCGCGTGTGGCCGC
CGGCGCGGGAAATGAGGGAAATGGCGGCGCCGGGCGCGCGGTGATGGGCGGCTCTGTGTA
TCTGGCAGACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTT
GTGCCTGGAGGTGGAGGGGAAGGTGAGTCGGTCGGGCCTGCGCGTGGGGGAGTCCGGGCC
GAGCAGGCTCGGGTTTCCGCCGCTCCCCCGCCTGAGGTTGTGCAATCCTCCCCGCCGCCT
CCTGGCGGAGGAGACGCTCTTTCCGGGCTTGGGTTTTTCTAGAAAACTGGAGGCGGAGCT
GATCCTGGAAATAGGCCCGCCACCTCGGCGCCCATCCTCCTCCCGGGGTTGTCCGGGACA
TGATGCCTCCAGGAGCCCCGAGCCCTTTCGTGTTTGCCCTGTCCCTACTTACCAACCAGA
GGCACCACGTGCCAGCAACTGGAAACAACTTTTTAATGACCCCATTTTTTGTTCCGGCCA
ACAGACAACTCTTTTAAGTTAGGCCGTTTTGAGAAATCCACGGGTCACAACTTTATTCCC
AAAATGGTGCTTTTTTTATTTTCAGCAAGAACTAAGAATACGTCTTATCCGTGACCTATT
GGCGTGGAAGGTGCTTTGGATGCGTTTGTGTCTTTTGCAACTATACTGCTTTTTCTTAAT
GGCAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCATTGGTGGAAATGCCT
CCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTG
TCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCA
AAGATTACATGAAATCGTAAGTGATACTGGCAGTACCTAGCTGATGTCTAGAATCTTACA
GGATTTAAAGACTGGCTAACTTTTGAGGTTCTTTCGCAGTGGATATACTTTTGTGAAAGT
CCTTGCTTTTTTATTAATGAGTTCACTGAAAAGAGTGGTTGCTTTTCTATAATAGCATAC
TGAAGGCTGCAGTCTGTTTCCGTTTAGAATTAGAATAGTATTTTGAAAATAGTCAAGAAA
TGTAAACATTCTTGAAAGATACTTTCTGTGAACTAGTAATTTCTTAACAGCTGGTTGTCT
TTTTCAGTGTTTTCTTTTTTTAAGCTTGGATATTTTTCACTTTAAAAATTGATTTTACTG
AAAATTCAATACTTCAACCTGTTAATGAAATGTTGTTTTAGAATCAAAGGGAAACTTGAA
GAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCAC
ATCCTTGCTAATTTCAAAAACTACCAGGTAAATACCTTAAGTATCTGGATCAAAGGATTG
TACAATTTTAACTGCAAGAGCAAAAATTAAGTTGATTAATCTTCAATTCTATACTAGTAT
TCCAGGTGTAGAAAGTGGCTTTCCCAGCTCTCAGGTGTTTCCAAATCTTGTCTTCTGATT
GAAAATTTGCTTCCCAGATGACATTTCTCAGTTTTTCTTTTCGTGAATTGCTTAACCACA
TAAGTGTTCTTTCAGTTTTCTGCTTACAATTCTAATGTGTCTCATTGCTACTGGTCCTCC
TTCTAATGTATCTGAGCTTGTTAAGTCTACTTTTGAAAAATGTCAGTGGCTTTCCCTTTC
CTCTGATTTTCCAGCTTCATGCATCCCCTGGCCATAAGATACTTCCAGACTGTATGATAT
ATTCTATCACTGTCAGCCTTATGTTCCCTGTGGGTAACTATATAAGCACGCTTTAGGGTT
TGGGATTGTATTTAGGACTGAGAGAGTAAAGGTTTCCTGAAAGGCTAGTGTTCCTGGATT
GCTCTGTACATTATTTTTCTATTTAGGTCACTATTAAGGTGCCTTAATCTAGTGAACAGA
TGTCTATGATAAGTGAGCATCAGAGCTTTTGGGTACTGGAGTTTTGATTTTTATGGTGGC
CTAAACCTTCCCTTGTACTGTAGTTTGAGTGGCATGTATTTGTATGTAATGGTCTAATTC
TAGGTATCTTGTTGCTTCCCAAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGG
TTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATG
GTTTAGAAATGGAAAAATGTGTAAGTACAAGGGAGTGGGTTAAAATAAGTAATGTAAAAA
AGATACTTTAGATGTGAGTTGCAATTGTTTTTTGACACTGAGATTGAGTTTTACAGCGTT
CTGAAACATGGTTTTAGTTTTTGGGGATCAAGAGAATTGTGTTTCATATGTAAAAAGGCT
TAGAATCTTATTTGTGGAAAACGTTGAGTGCACATGGGGCATAATAAAGTACAGTTTAGG
CTGAGCGTGGTGGCTCACACCGGTAATTTCAGCACTTGGGAGGCCGAGGTGGGTGGATCA
CCTGAGGTTGGGAGTTCGAGATCAGCCTGGCCAACATGGCGAAACCCTGTCTTTGCTAAA
AATACAAAAATTAGCCAGGCATGGCAGCGGGCACCTGTAATCCCAGCTAATCGAGAGGCT
GAGGCAGGAAAATCACTTAAACCTGGGAGGGGGGTTGCAGTGAGCAGAGATCCCACCACT
GCACTCTAGTCTGGGCGACAGAGTGAGGTGCTGTCTCAAAAAAATACAGTAGAGTTTAAA
TGCTGAAGGAGATCAGAGAACACCATTGATCTTCCTCTAGATATGGCCTCACTTTCACTT
CATAATTACGTTTTGCTGTATACGTATGGATCAGTATCAGTGGTTTTCACTTTGGTTTAC
TGATAACGGGCAGCTGATCATTGAAAAGCCTAGTGCAGTACTAGCTTTTAGTAAATAGAG
CTGACTGCTGAACTGGCATGCAAATTGCTTTACTAATAATAAATAACTCGGTGTCTGCTA
TGGAAGGAACTGCTGGAAGCTGTACAGAAACAAAGGCATTCATTATCCTAGCTTTCATAG
GCTTCTATATGTTAGGAAGAAGATAAACATAAAGCTATACTGAACAAGCAAGATTAGAGT
CAACAGTAGACAGAAATTACTTAGAACAGCATAAGATGACTTACCAAAGGGGTTATTCAG
GCAGTATCTGAGGTTTTTGTTGGTAGAGCAGGGTGTTGGGTGGTACATGCCACAGCCTTC
TGGAAAATGAGCTATCGCTGATTTGGTAAGGGTGTTCTGCATCCACTGATAGACCTTGAA
CAATTTACTGTTGTTCTTTTGGTTTGCACTAGGATGCAAAAGAAAGAAATCCCTGCGCTT
TCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGGGGAATACATCTATAGCCTAGAAATG
TAGGCTGCATGTTAATGGTAATGTAACTTTTGCAGTGTAACGTTTGAAAAATATTAATGT
AGTTTTTGTTTTTACAGTAACAAATTTGGCAATTATTTTGGATCTATCACCTGTCATCAT
AACTGGCTTCTGCTTGTCATCCACACAACACCAGGACTTAAGACAAATGGGACTGATGTC
ATCTTGAGCTCTTCATTTATTTTGACCGTGATTTATTTGGAGTGGAGGCATTGTTTTTAA
GAAAAACATGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCATTTGAGAGAAT
GCCTTTTAGTTTAATGCATATTTAAACTAAATTCATCCTGTAGTGTTCCTGGAGAAGCTA
GAGCCTGGTTGTAGGCTACTACTCATCAATTAACTTCTACAGTGGAGACTACTTCTGGGA
CTGGAATATAAAAAAGAATCAGAGGTTTTGATTTTGAGTTGCAATAAAGGGAAAGACCAT
GCTCATAGCAGTGCCGACATCTGAAGTGTGGAGCCTTACCCATTTCATCACCTACAACGG
AAGTAGTTAACTGGAAGAGATTACCAAGAGAATAAAAAGAGACTCATTCAGTGGAAGCAA
CTTTGTCTCAGCTTATTTCACATAAAGAGAGCCAAGTCTCTTGGGATGAATGTTAAACTC
CCTGGTAACTAGAACAGGGACTGGCAAACTAGCCTGTCCGACCACCTGTTTTGTACACTT
TAAGGTGGTTGGTTGCCTTTTTAAATGGTTGAGGGGAAAAGAATACCTTGTGGGATATGG
AATTTAAGTTCGAGTCCAGTTTTATTGGAACGTGGCTATGCTCATTCATTTATGGATTGA
CCGTGGCTGTTGTCAGGGCATGAGCAGAGTTGTGTCTAACAGACTAGAACCTGCAAGTTT
GCCAGCCCCTGATTTAAAAGATGAAGGTACACAGAATGTGGGCTGGCTGGTGGGCAAAGG
GGTAAAAATGTTCTCTATTTTGTATCTGAAAAGACGGCGTGTCTGAATAAGAAAATGCAT
CTATTTGACAGACCTGGAGCAGTTGCCATCTGCTGCTAAGGTTTCCGCCACAGATGCAAG
AAAAACGTGTCCTTGCGCTTTCCGTCTGTCTAATTGTGGCAGCTGAGATTGAATAGACGA
ATACAGGGGAAAAAAAAATGGGAAGAGTTTTTGAGGCAGGTCGGTCACCCAGGCTTGTAG
TCCAGTGGGCACAAGCAACGCACTGCGTTCTCTGCATCCTGTGCTCAAGCCATCTTCCCA
CCTCAGCCTCACTAGTTGCTGGGACTGCAGGCATGCACCCCTATGGCCAGCTAATTTTTG
TAGAGACTGAGTATCGCTTAGTTGCCCAGGGTGGTCTCAACTACTGGGCTCAAGGAGATC
TGCCCACCTCAGCCTCCCAAAGTGCAGGCCCACCCTGGGAGGGGAATTTTCAAAAAGTGA
GGTTTGGGAAATAGTCTCTACCAGCCTTACCTGGTTGATTACACTTGTAAAAGAAAAGAT
TAAAAGCAAGCCGGTGACTCTGGTCTGCTTGAACATGTGAATGTAGTGGTTTGAGCAATC
TG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1191, 1448..1521, 2045..2235, 2621..2726, 3443..3559, 4817..5301
1164..1191, 1448..1521, 2045..2235, 2621..2726, 3443..3559
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved