Pongo_pygmaeus Locus RPL21
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPL21
Pongo_pygmaeus
RPL21
13
SNORD102, SNORA27
2158..2230, 2496..2621
4625
ACAATTTTTATAAAAACGGTACTTTGGGAGCCGTTCTTAAAGGATTGCTAGTAAATTTA
GAAACCAAATTGTGTTAGAATATTGTCAACACGTTAAGCCTGACGGCTGTATTTTACCTT
ATGGTAGGAGTAATGGCCAGGAATGGCACTTCTGCCCTATAATGACTAAAGAGCCATCAA
AACTATTGTTTTGGCCTTTTTGGGAAACAAAGGAAAGGTTAATTTCTAAATGCCTGTAGG
TGAATTCTTAGATAATGATAAATTACCTGCCAGTTACTACTGAGCACTTTACACGGGCCA
AGCATTGGTGAGTTCTTTGTAGACGTTACCTCAGCTACGAATGTGTTCACCCCTATTTCA
CAAATGAAGATGAGAGATGAAATGTGGGTTTCGCAGCTAGTAAGTGGCAGAGCCTATGTC
AAATTTAGGTCAATGATTATAAAGCCTGGGTTCCCCTCTCTTCTACCCTATGTACGCTCG
TAGTAAATAATCAGAAATGTGAAGTGGCTTGAGATTTCTGATAGTTAAATAGATGGTGTT
TAAGATAGACCATCACGGAAAATTGGTTGACAAGAAAGGTTTAAATCACATAAAAATGTA
AGGCTGTTTTATTATGTTCTCCAATAAATTATTTTCTAGTTAGTAATTACATGCCCTTGG
CATTCTAGATTGGGTTCTACAGATAGAGTGTGGTAGAAGTCCTGTTGTGTTCTTATATTC
TCATAGAGAAAGGGTACTGGTTTGGATTCTCGTATCAAGTTTTGCTGCTTAAGAGTTTTG
ATGTTATAGAACTTGAGCAGTTTTGCCAAAAGACCTTACTTGCTAAAATAATGGTTTTTT
AACCTTTCAACAGAACTAACTGCTTGGTGATCCAACTTTCATTTTGCAGTTCTCACTTTG
CTACTGAAATGTGAACATTTGAAATTACAGGGGTTTGAGGCAAATGCCAGTTTTCAGTCG
TATTTGACTGTTATGCTTTCTGGTTTCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
AGAGGAGAGGCACCCGATATATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGTGGGTTT
ACCTTTCTTGAGAGAAGCATGGCACACACTTGTGTTCTGTTGTGTTCAACATGTGTTGTA
GTTCATAGAATGTGTATCAATAGCATTAAATAACTAGCGTCTACTCAGCTTATTTTGTGA
TAAGGTAAATAAATTACCAAAATTATATGGTAATTCTGTGACTAAATATTGATGGAAGAT
TAAACTTTGGAGAGAGGTTGTGATTTAGTAGGCTGATTGTGCTTTCAGGAGAAATTGTCC
ATTGGCAAGATAATAAGCATGTAACCATCAAAAATGATATATGTGTTGAAAGCTAGTAAA
ATTGCATTTCTTTTACTCTAGACTTTTAGCCTTAATACTCACTATACCAAATTTATTCTT
GTAGGAGTTGTTCCTTTGGCCACATATATGCGAATCTATAAGAAAGGTGATATTGTAGAC
ATCAAGGTAAACATAAAATTGGGAAAATAACTACAGAAGTTAGAGAAGTTGGATTTAATC
TAGTGTAGGAATTCAAATACTAGTGTATATTGCATTTGTAAGGGTATAGAATGGAATTTA
TTTTATTTATTATTTTTTTTTTTTGAGATGGAGTTTCGCTCTTGTTGCTCAGGCTGGAGT
GCAATGGCGCGATCTCGCCTCAACCTCCGCCTCCCGGGTTCAAGCGGTTCTCCTACCTCA
GCCTCCCAAATAGCTGGGATTACAGGCATGCACCATGATGCCTGGCTAATTTTGTATTCT
TAGTAGAGACGGGGTTTCTCCATGTTGGTCAGGCTGAACACCTCAGGTGATCTGCTGGAC
TCAGCCTCCCAATGTGTTGGGATTATTACAGGTGTGAGCCACCGTGCCCGGCCTAGAATG
GAGTTTTTAAAGTGCTATTCTTAGCAGAATTTAAATTTTCCTCATTACCTGCTTGGAGTT
AACGGCTAGCGGAAATTGGGTGGTAGGGTGGGAAATTATGAGTTTGTCAAGTTGGAAAGG
AACGCCTTAATGCAAAGTTTAATTATTGGTGAAGATTACTGTTACTATGATTAAAAACTC
ACCTAGTGAAAGCTGTGTTCTTCTGTGACCTGGATTTAAATGTATCTTGGCACTCTAGAG
CTTAATGATGACTGGTTTTTTTTGATTGCTTGAAGCAATGTGAAAAACACATTTCACCGG
CTCTGAAAGCTCTTGAGTTGCCATTTGAAAGAAATCTTAGAATACCTTACAGTTACTTAA
AATTAGATTTTTAAAGGAAAGGGAAATGCTAGTATATAACATTGGTCTCTTTAATAGGGA
ATGGGTACTGTTCAAAAAGGAATGCCCCACAAGTGTTACCATGGCAAAACTGGAAGAGTC
TACAATGTTACCCAGCATGCTGTTGGCATTGTTGTAAACAAACAAGTTAAGTAAGTAGTG
TTGTAGTTCTTTGTGGCTAACCGGTATTCCCTCATATGCCCCCTTTTCACTTTGCCAGTT
GGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATATCCTTTTAAAACTCAG
GCAAACTGGGTGTTTGTCTGTATCCTGTCAGAGGAAACAAATTGAAATAGATTTACTGGA
AAGTCTTACACAGTTTGTTACTAAGCAGTTTTTTGTTTTTTTGTTTGTTTTGTTTTGAGA
CGGAGTCTTGCTCTGTTGCCCTGGCTGGAGTGCAGTGGCGCAATCTCTGCTGTCTGCAAG
CTCTGCCTCCTGGGTTCACGCCATTCTCCTGCGTCGGCCTCCCGAGTAGCTAGGACTACA
GGTGCCCGCCACCATGCCTGGCTAATTTTTTTGTATTTTTAGTAGAGACAGGGTTTCACT
GTGTCAGCCAGGATGGTCTCGATCTCCTGACCTCATGATCCGCCTGCCTCGGCCTCCCGA
AGTGCTGGGATTACAGGCATGAGCCACCGCGCCTGGCCCAGCAGTTTTTATAGAATAAAA
AGAGAAGTTTAGTAAACTTTAAATTTTTATTAGTCTGGTTTTAGATTACTAGAGTTTAAG
AGGCCATCATCTCATCAAAGAGAGTTAAAAGTAGGGATGTTCTCTGCAAGGCCTTTTCTG
ATATGATTAATAAATGACTGTAAATTAAGTAATCAATTGTTGATTTGTCATATCTGGGTA
AAAGGTTTATGGTTTATTTAATAAATGAAACTGCAAAATCAGTTTTCTGCATTTCTGTTA
TATTTTTGATAAAGCACTTAAAAGAATTTCTGCTCTGTCCAGGGGCAAGATTCTTGCCAA
GAGAATTAATGTGCGTATTGAGCACATCAAGCACTCTAAGAGCCGAGATAGCTTCCTGAA
ACGCGTGAAGGAAAATGATCAGAAAAAGAAAGAAGCCAAAGAGAAAGGTACCTGGGTTCA
ACTAAAGCGCCAGGTGAGAATTTGGTGTATATTTCATTGGTTCTGAGAGCACTTTAAGGT
TGAGATTTAACACATCACATAATTATTTTATTCCCTTTTTTTTTTTCCTTTAATAGCCTG
CTCCACCCAGAGAAGCACACTTTGTGAGAACCAATGGGAAGGAGCCTGAGCTGCTGGAAC
CTATTCCCTATGAATTCATGGCATAATAGGTGTTAAAAAAAAAATAAAGGACCTCTGGGC
TACAAAAATGTTTCTCTTCATTGAGTAGAAGTGTGGTGTCCTCTCCCCCAAAGAAATATT
TAAAGCAAATTTTGGTTGTGTCCTAATTCATTATGTAATGTCTTTGCTATTCAAATTTAA
TGTATTTCTTGCTGAAGGACATGAGGTAGCTTATTGTGCAACAAATTACTCAGTTGGTTA
GAAAATGGCAAGGTATTATATATGAAATATTTGTACTGGTTTGAAGATAGTCCTTCTAAA
TCATCAAGGAAGAAATTTAAAATATTTTTTTTTGAGACAGAGTCTTGCTCTGTCAACCTG
GCTGGAGTGCAATGGTGTGATCTCGGCTTACTGCAACATCTGCCTCCTGGGTTCAAGCAA
TTCTGCCTCAGCCTGCTGAGTAGCTGGGATTATAGGCGCGTGCCACCACGCCCGGCTAAT
TTTTGTATCTTTAGTAGAGACAGGGTTTCACCATGCCGATCAGTCTGGTCTCAAACTCCT
GACCTCGGGATCCACCTGCCTTGGCCTCCCCAAAGTGCTGGGATTACAGGCGTGAGCCAC
TGTACCAGGACAAATAAAATATACAAAAATAAGTGGGATGTCATCTATTGCATTACAGTT
AAGCTCAGGATCCAGAGTTTGCTTTTGAATCCTAAAAAAAAAAAAACCAGATTGTTTAAA
GCATTCATTCTTTGTGTGTTATATACTAGCTTGGAATTGCTTTGACCATGCATGGAACAG
GACTCAGAAAATAATAGTGGTAATAGCGTTTGTCTTAGGCCATTGTCTTGCTGTAACAAT
ATACCACAGACCTGGGTAAGCAGTAGAAGCTTATGTGGTGGTTCTGGAGGCTCTGATGTC
CCAAGGTAAAGGTGCTGGCAGGTTCGGTGTCTTATGAAGGTTTGGCCTTAACTAACTTAC
CTCTTGATAACTGCCACAGTGGGAGTTCCTTTTTTTTTTTTTTAATTGAATGTTTTATTT
TGAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1444..1505, 2337..2449, 3282..3432, 3536..3625
1001..1067, 1444..1505, 2337..2449, 3282..3432, 3536..3622
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved