Pongo_pygmaeus Locus RPL30
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPL30
Pongo_pygmaeus
RPL30
8
SNORA72
4336..4467
5758
GCAGGGCGCCACCGTTCTCCAGGGGACAGGTAACTGGGGTGACCGCACGGGTGAGGACA
CAGCTGCTTCTACCAAGCGGAGAGTAAATGCCGGTGCTGAGGCGCATCGGAGTCACCCAC
AAGGCTCTCCAAGAGCCGCGCCTCAGGGCAAAGATGAATTCAGCGGCATTAAGCACGTGG
TCGCTGCCGCCGCAGCCTCTTCTCATCGACCCTCCCACCTCACCTTCAGTCGGCTTTTCG
AACTCCCTCCGGGTTCTAAGCGCCTCGATTCGTTAGACCGCAGCTCGCAGCAGAACAGCA
ACACAACGCCGAGAGGCTTAAAGGCCCGCAGAGCGGGAAAGCGAACACCCCCGCCGCCAT
TCTTTTTTTTCCTTCTTTGAGACAGTCTCACTCTGTCGCCCAGGCTGAGTGCAGTGGCGC
GATCATGGCTCACTGCAGCCTCGACCTACCGAGCTCAAGCGACTCTCCCGCCTCAGCCTC
CGGCGTGGCTGGGAGTAGCTAGGACTACTGGAGCGCGCCACCACGCCTGGCTAATTTCTT
ATTTATTTATTTATTTTTTTTGTAGAGACAGGGGTGGTCTATGTTGTCCAGGCTGGCCTT
GAGCTGGACGCAACAGATCTTCCGGCCTCAAGCTCCAAAAGTGCTGGGATTAAAGGTATG
ATCCGCCGCGTAAGGCGCGCGCAGCCATTCTAGCTAGCGGTACCAATAGCAACGGGCAGC
GGCCCCCCGCTTTTGCTCCGCCCCTTCTGCTTACTATCTGTTTCCGCTTCCGGTCCTGCA
GTTCCGGCTCTGCCGTGAAGAGCTTTGCATTGTGGGAACTCTTTCCTTTCTCGTTCCCCG
GCCATCTTAGCGGCTGCTGTTGGTGAGTGGGCTCCTACCGACCGAGGTTTAGGCAGCGCG
GGGAGCTTTGCGGGTTGCCATTTGTGATTCCGGATCCTAAACTTCCGTCCTGTCCTCTGT
CTCTTCTAGGTTGGGGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGA
CGGTGAGTGAGGCGGGCCAGGCCCGGAAGCCGATTCACGTGGAGAGATGTCTCGGCCAGG
GCGGGCAGATGTGAGCCCACTGGGATGACAGCATGCTTGCTGGCATTTGGAGGGCCCCAG
AGGGAATCCCAGTGGCCCTCTCAATGACTTGGGGTCCTCGACTTCGGAAGTTTAAGGGGC
TCGGCTTCAAAAAGCTGGGTCCGGTTTTGAGGTGGTTGCACGCGAGGCCCTTAGGTCCGT
ATTTAATGTTTGCTTTGTAGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCTTCAACTCG
TTATGAAAAGTGGGAAGTACGTCCTGGGGTACAAGCAGACTCTGAAGATGATCAGACAAG
GCAAAGCGAAATTGGTCATTCTCGCTAACAACTGCCCAGCTTTGAGGTAATCGAAGAAAC
TGAACGGGCGTCGCCTACCGCGAATTCATCGTGAACGAATATACAGGAGTGTAAACTTGT
AATCTGAGTACCATGAAACTCGAACACTTGCAGGATAATTACGGTAGCGATTGTGGTGTT
TGGCCCTTCATTCCCGTCTCCCCCACCCACCCCCAAATCATGTGCTCCCCTTCTGTGAGC
TTATTTTTGGGGGAGAAATGTGTGTGTGGCAGGAGTGAAAACAGAACATCGCGGTTTAAT
GGAAGCAGACACATTGTTTTTTCCATGTATTTTGTGTCCTGCTTTTTTGGTTCTTTTAGC
TTTGAGGTGCTTTAATGACGCTTCATTGTGTGAACTTGTTTTAGTGTCAGAAAACTAGGT
AAGAAAAGTTGAGGCTGGGCTATGGAGTTGCAGGCTATCATAGAATCACCTAGTTTAGCC
CACTAAATCAGTTCTGAGTCAAGGTTTATGCTTGACTCACTGTTTTGAAATTGAACTTAG
GGGGTGTTGTAAATAAGCCAAAGAAACTTAGACCTTGCAGAATATAAGCTATGTGACCAA
ATTTTCTGTGGTGATGCATAAGCTGCTTACAGCATTTTATATAGGGTGTCTGTAGTTACT
GTCAAAGCCTGGAGGGCCCTTTCTGTCTCGTCCCATGGGTTGGGCTTTTCCCTAACCATT
CCTTGAAACTTTCTTTAAAGCCTGTCTTCTATAGTAGTGCTTCTGAAACATGACTGTGCA
AAGGAGTCACATGGGTGATGTTAAAATGCAAGTTCTGATTTCATTGGATTTGGGATGGGG
CCCGAGGTTTTGTTTTTTTTTTTAAGACAGAGTTTCGCTCTTGTCACCCAGGCTGGAGTG
CAAGTGGTACAATCTAAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAGCAATTCTCCTG
CTTCACCCTCCCGAGTAGCTGGGATTACAGGCACCCGCCACCACGCCTGGCTAATTTTTG
TATTTTTAGTAGAGATGGGGTTTCGCCACGTTGGCCAGGCTGGTCTCGAACTTGTGACCT
TAGGTGATCCACCCACCTCGGCCTCCCAAACTGCTGAGATTACAGGTGTGAGCTACTGTG
CCCGGCTTGAGGTACTTTTTTAACTAGTACATTGTAGCACTATTGCTGGTATGTGGATCC
ACATAATTTGAGTGGCAAGATAGTATAGGACTCCTTTCCGATTCCTAAAACCATTAGTAT
CTACTAAATTGACGCTGAAATTTTGTATTTTTAGTAGAGACAGGGTTTCACCGTGTTGGT
CAGCCTGGTCTGACACTCATGACTTCAGGTTGTCTGGCCTCCCTTATTGTTGGTATTACA
TGCGTGGAGCCACATATTTTAACTCTCTAACTGCATCACTCCGCATCTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTCATTAGATTAAAAAAAAAAAAAAGAATAGGG
CTGTGTGCCGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGCAGATC
CCTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTAAAACCCTGTCTACCAAAA
ATATAAAAAATTAGCTGGGTGTGGTGGTGCACGCCTGTAATCCCAGCTACTTGAGAGGCT
GAGGCAGGAGAATCACTTGAACTCAGGAGGTGGAAGTTGCAGTGAGCCGAGATCGTGGCA
CTGCACGATGTGCCTGAGTGACAGAATGAGATTCCATCTCAAAAAAAAAAAAAAGAGTAC
ATAATACCTACTTTAGAGATAGTCATGGAAATATAAAGTATGTGGCCCTTATTAATGCTA
CATAATGCTTTGCTTTCGTTTATTTGCATCTTACCCTCTTCCGTGAGTATTGATACTGTC
TTACTCATAGTAGGGGTTGAGTAGATATTTGCTGGTTGCCCCTTCACTTGCAAGGGATAC
ATACAAATGTTGGTTTGTATTGGATAATGAATATGATGTTTTTAAGAGTAATGTATGATT
TTGTTACTTTTTGAAGGCCTTAGCAACATTAACACTAGTAAAAGAAGTAGTAACATTTAG
TCTGTCAGTCACTTGGTATCGCATTTATTTATTTGCCCTTTTTGGTTCCCAAAGGAAATC
TGAAATAGAGTACTATGCAATGTTGGCTAAAACTGGTGTCCATCACTACAGTGGCAATAA
TATTGAACTGGGCACAGCATGCGGAAAATACTACAGAGTGTGCACACTGGCTATCATTGA
TCCAGGTATGCTTTTTAAATCGTAAAGTCTTTTTTTTTTTTTTTTTTTGCCTTTCTAATG
TAATGTCTGGACAAGTATTTCTTACTACGCAAATGTCTTTGGTTCCTAAATTCAGATAGA
ATATGGATCTAGCAAGGCATATCCTGTGGTTGTATTTTGTAGAGAATTGGTAATGAATGC
CAGTACTTTATAATTGGCTTTATTATAAGTTAAAATTTTTACTGTCAGATAATGAATTTC
ATTTGATGAAGTACCTACAAAATAATGACTTATAGATTTGGTAAAAGGTGAAATAAGGAG
AGAATAATCTGGCAAAACGGAAGAAAGTAATTCTTGCTTCCTGAGAACAGACATGTAAAA
TTAGCTTGAGAAAAAAAAAGTGCCGAAAATCTACATCATTCTGTTTTCCAATTGTGAATC
TTTGATTCATAGAATACTGCGAATATTCTCGCTGTTCTGATTTTGTAGTAGTCAGGACAG
GCTAAACATTCGCTATATTAAGACCATGCATGTGTCCCCAAACCTAGTTATTTCCCTAGG
TCTGGTTTTATAAATGCTGGTGATAAACCAATTTTATTATATGATCATTTTGTGTGATTA
TATAATGGCTGTGATTCTAGGTTATCTTTGGTCAACCTTAAGAAAAATGACAGTACAGCT
AATGTGATAACTTTTGCAAAAAATCAGTTCTAATTTGCAGACCATTGTCTACAGAAGGGA
TAGCCAAAGGTAGAGAAATTTTATAGTACCAGTTGCTATTAAAAGAATTGTAAAATTACT
TTTTTTTTTTTTTTTTTAATATTTTTTAGGTGACTCTGACATCATCAGAAGCATGCCAGA
ACAGACTGGTGAAAAGTAAACCATGCAAAATTTTCCTTTAATAAAATTTGCTTGTTTTAA
AAACATTGTATCTATTTCAGTATTTTTTTTTTTTTTCTATTTTTTGTTTCAGTACAATTT
CCTGAAGGTTGGATTAGAGAGGATGAGGCAGATGTGGTGCAAGACTTTTTCATTAAAGAG
TTACAATCCTGGGNNNNNNNNNNTTTTTTTTGGAGCAATAAAACTGCTCTGTCGCCCAGG
TTGGAGTGCAGTGGTGCACTCTTGGCTCACTGCAGCCTCTGCCTCCCAGGTTCAAGCGAT
TCTCCTGCCTCAGCCTTCTGAGTAACAGGGACTACAGGTGGGCGCCACCATGCCTGGCTA
ATTTTTTTTTTTTTTGTATTTTTAGTAGAGACGGAGTTTCACCATGTTGGCCAGGATGGT
CACGATCTCCTGACCTCGTGATCCCCTGGCCTCAGCCTCTCAAAGTGCTGGGATTACAGG
CGTGAGCCCTGCTCCTGGCCTAGTTTTTGTAAAGGGAGTGCACTGGGTTCCTTTCTAGTA
CTAGATGTTTAGGAAGCTCAAGTTTTGTAATTCCATTCTCAGGACATTGTTTGCATTTTA
TATTCTAGTATGCTTAGGAGGCAACAAGGTTAAATACCCAGAATTTAGCCAGAATTGCAA
TTTACCAAATCTGAGTAGCTAAAAAAGATTAACTGAAATGTTTCCCCATCCAAAATGCTG
TCATAGGTTAAGAAAAGTTTTACTTTAATGAATAATCTTTCCTAAGGTAAGTGGTTGGTG
CACTTGGACGATCTCTGAGTAATCCCAGATCATCAATAGTTAAGTCCATGTTTGCCCGAG
TATGTTTTATATCATACACCTAAAAGATGTACTATGAAGTACGTTAAGTATTCACATTTT
TGGAAACTATACTGCATCCCCCAAGAGTATGTCCCAGGGAATCCTTCATATGTTAACATC
TTTTGGAACATTCGAAAGAATTAATTTGAGGGGAAATAATGATTTAGTTAGATACTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1280..1425, 3774..3904, 4709..4758
1001..1021, 1280..1425, 3774..3904, 4709..4755
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved