Pongo_pygmaeus Locus RPS12
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPS12
Pongo_pygmaeus
RPS12
6
SNORD101, SNORD100, SNORA33
1539..1611, 3026..3104, 3443..3572
4762
TAGAAATAGTGAAAGCGGCCGGGGGCAGCGGGTCACGCCTGTAATCCCAGCATTTTGGG
AAGCCGAGGCGGGTGGATCCCCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGT
GAAATCCCGTCTTTACTAAAAATACAAAAAATTAGCCAGGGTGGTGGCAGGCGCCTGCAA
TCCCGGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAACCGGGAGCCGGAGGTCGC
AGTAAGCCGAGATCGCGCCATTGCACTCCAGCCTGGAATAGTGAAAGCGTGTAGGCTCTC
CTTTCATGAAGATAAAGATGAGGATCACACCCACAACGACACAATCATGGTCTCTCAGGG
TGACTTAGAAGCGAAGGAACAAAGTGCGCTGCCTGGGAAGGCTGGTTCTTGTAGAAGCAA
CAGGAAAGTAGAACGTGGTGTGGAAAGGGTTAAAACTGGCGCTCGGCGGGATACAAGGCT
CTAGGTGCCTTAAAGACCACGCGGACACACTTGTTTGGCTCCTGTCGCGCTCCGTAGAAT
GAGTTCCCTGGGCCTCGGTGGGCCACGCCTCCGCAAAGAAGAACAACGCGAAGCTGCCCG
CGTAGTGCCTGTTGCACTCGCCAAGGACCGGCCTGGCAGAGATAGAAAACTCGCAGTACT
CTTGCCTCAGAACCGCCTCAATCCGGAAACACAAACTCCCCAGGCCCGGCACCGAGGGAG
CCACCTCTTTCGAGGGTGGGAGTGCACATGCGCACAGGGGGCCTGAAAAACCCTTAAATA
CCGGCATGCGTGCGGCTGAGGCCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAG
GCTTGGGGTAAGTTGAGTGAGGCGGCAGGGGGTGTATTGGTTATGATTTGTGGCTCGTTG
TGTTCTTGCTGGGATTGGTGACGAGTATCTGGTTCTTTAACAGGTCAATACTTTTGTTTT
TTAGTGCGTTCAAGATTCAGCTTCGCCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
CTCAGGGGCCGGGGTTGGAGTTGGGGTCGCGGTGTGGCTGAGGCGTGGGGCTAGAACTGG
CGGAACAGGACTGGGTCAAACGGGTCGCCGTAAGCGCGTCTGTTGCACGCTTAGCTTTTG
CTGAGTGCAAGGTCTTATGTGGTGTGAGGATTTTAACTGATGGTTCTGATGTGTTGCGTT
TCAGCATTGCTGCTGGAGGTGTAATGGACGTTAATACTGCTTTACAAGAGGTTCTGAAGA
CCGCCCTCATCCACGATGGCCTAGCACGTGGAATTCGCGAAGCTGCCAAAGCCTTAGACA
AGTACGTGTATCAGTCTCAATACTGTGGGTTCTTGCAGCCGGAACAAAACTGCCACCCAA
GGGAAGAAGGCATGGAGTTCATGGTGTTAGCGCAAAAGTTCTGAATGGCATCCGTCCTAC
CGGAAACCTAGGAAAAGGTATCAGAACTCAGATCTATAAAGCCCACTTAAAATGTGTGGG
TTGCTGTTTGGAATGGGGATACGCACTCAAAACTACAGTGTTTGAATGATGACTTTAATT
GTCGGATACCCCTTCACTCCTTTTATGAGTGAAACATAAGAGTCTGACAAACCTGTAGGT
TTTGGGGCTAGTCACTTTTATACTTACCTGGCGGATAGATGAGATGGAGAGCCACATTAC
ATCTGGTAGTTTGCAAAACAAGCATTAATTTAATGGAATTTCAAACTCAGGTTTCAGAAG
CATTTGGTCCTAGATGAATTTAGTAGTATAATAGCTGTGATTTATTTGAATTTGGGATAT
TTGTTAATGTATTTGAATGGGTCGAGTTAATGTGTTTTTTAGGGTGGTGGTATTGACAAA
TCAACCTATTCTTGAGCTGAATTTAAATGCAGTTTTAAGGTTTTACAGGACAAGTTCGTT
TTGGTGTAATCTAGCCAATTCAATCCGATGGAAACGGCATTATTGTTTAATGTATTTAGT
AGGTCCTAGTATGAATTTTCTGTATTATTTCTATTTCGGCAATATTGCAGGGCATTTCAT
AACTGTTCCATTAATGCCACAGCTTTTTTTTTTTTCTTTCTTTTTTTTGAGACAGAGTCA
CGCTCTGTCCCCCAGGCTGGAGTGCAGTGGCGCGATCTCATTGCAACCTCTACCTACCAG
GTTCAAGCGATTCTTCTGCCTCACGAGTAGATGGAATTACAGGCACACGCCACCATGCCC
AGCTAGTTTTTGTACTTTCAGTAGAAACGGGGTTTCGCTATGTTGGTCTCAGGCTGGTCT
GGTACTCCTGATCTCAGGTGATCTGCCCCCCTCGTCTTCCCAAAGTGCTGGGATTACAGA
AGTGAGCCATTGTGCCTGGCTTTTCACATGTTTCTTTAGATATATGAAGCTGGCTTACAA
GAAAGCTATTATGGTTGGGTTTGGGCCACAAGTTTTAAAAATGACTTATACCAATTCAGT
GTGTCAGGGAAAGAGGTTTTACTGAAGACCAGTTGTAGGTTAATTGAAGATGTACATGCT
CCCTAGCAGGTTCTCAGACTTAAGCAATTTTGTACGCATTTGTGTTCAGTGGATTTGCTG
CTTATGTTTTGCAAGTGTTAGTGCAAAGATAACCCTCCTAAAATGCAAAAATGATGGGTT
TGGATCTGAGTTTTAGCTTCATTTCCATTGTAATTTGAATTTCAGGCGCCAAGCCCATCT
TTGTGTGCTTGCATCCAACTGTGATGAGCCTATGTATGTCAAGTTGGTGGAAGCGCTTTG
TGCTGAACACCAAATCAACCTGATTAAGGTAAGGCTGCTAAGGATTGTGTTGGGACTAAT
GTTCAGTGATGCTTGTGTACCAGGGTAAATTTTGTGAAGTCTCAAGCTGTTCATTTTGTG
CAAGTGTAAATATTATGTGCACCTGATATTGTCGGCCATTTTAAAGATGATTGTAGGTAG
AAGCATTTTATACCTGCAGAATTGAATCCTAATTTTGACGTTGGTATACAACAAAGATTA
GTAACAGGTTTGTAGGTGATCTTTGTGCTGTACATGATGACAACTGGCTCCCTCTACTGA
ACCCATGCCATGAGGAAACTGCCATGTCACCCTTCTGACTACAGCCACCTTTTGAGTTTA
ATTTAATTTTGGTAATGTTAATGTCTATTAATGTGATTTTTTTTTTTTAATTTTCTCCCA
ATAGGTGGATGACAACAAGAAACTAGGAGAATGGGTAGGCCTCTGTAAAATTGACAGAGA
GGGGAAACCCCGTAAAGTGGTTGGTTGCAGTTGTGTAGTAGTTAAGGTAAGTCACCGTTT
ATTTTAGGGATGAAGGTTATGCTGGCTAATCATATAAAACCTTATATTGAAATAAGTTGA
GGATCTTATAAAAGGAAAAAACTGATTGAACAGGTTTAAAGCATTTTCTGCATTTCAGGA
AAAAAATAAAAACTGTAATTTACAAGCCAGCCAATGAATCTGCTTACCTGATTGTGTTTG
TGCAGACATACTTTAAAAACTGGCAATAGTAAAGCCATGTTACGAGCCTTAAGGACATTG
AAGTCGTTAAGGTCCCTGAAAATGGCTATAACAAATCTTAGTGATGGGAAACATTTTTAT
AAGACATATCTAATTGTTGAAGCTCCACTACAATTGATACTAATAGCTTGGTGAAATTTC
TAAGTATTAACAAGAAATTGCATGCGTGTTTTTTTTTTTTAAGGACTATGGCAAGGAGTC
TCAGGCCAAGGATGTCATCGAAGAGTATTTCAAATGCAAGAAATGAAATAAATCTTTGAC
TCACATTCCTCATGTCTGGCTTTTTATTTGGGGCAGTAAAATAAGGTCCCCGTTAGCAAA
GTAAAATGTAATCATCGCAAAGTGATTACTACAGATTAACTGGAAACTTGCTCTCAAGGT
CTTCTCCCCAGCCAATGACTACATCATGGGGCAATTCAAACCTGGACAGCCTTAGCAAAG
ATAGGTCTGCCATGTGGTGTTGGTGATGGCCAGTTACTTAGCTTATGGGCATTTATCCCT
CACTAGGCTAGCCTAGAATCTGGAGAGAGAGGCTGTGTGTTTTTAATAGGTTGCAGTCTA
TGAAAGGACAGTGAGTAGACTTGCTGGGCAGGTTAGTAGAAAGTACACAGTTGGGCCAGG
ATCATATCTTGCCTGTGGGACAAGTCTATGATGCCCAGGAATGCTTGCGGACATTCGTTT
GACTTTTTTGGTTGGAGACGGAGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGCGC
AATCTTGGCTCACTGCAACCTCTTCCTCCTGGGTTGGAGTGATTCTCGTGCCTCAGCCTC
CCAAGCAGCTAGGATTACAGGTGCCTGGCAATTTTTTTGTATTTTTAGTGGAAATGGGGT
TTCACCATATTGGCCAGGATGGTCTAGAACTTATGACAGCAGGTGTTCACCAGTTTCAGC
CTTCCAAAGTGCTGGGATTACGAGTGTGAGCCACCATTCCTGGCCTCATTGACTGTTTTG
TGCAGGAGCGAGAGGGGCTTGAATGCACGTGCACCCAGTCCCTAGAAATCTCCACAGTGA
GAGAAGCCGTGGCTGGTGTTTGGTGTATTTTAAACTTGGATAAATGTACCGTTAAAAGAA
TGTTGTGAGGCCATATACTTGGCCAATCCTGGTTTTGAAAACTTTATACCAGTGTTTTTA
TTTTTATCTTATACATAACAGGCTTAGGGCCTTGATGAGAATCTCAGAGTAGGGTCTCCC
ATGCTGGTTGGTTTGGTAATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1204..1320, 2685..2787, 3184..3285, 3703..3762
1001..1014, 1204..1320, 2685..2787, 3184..3285, 3703..3762
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved