Pongo_pygmaeus Locus UAP56_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus UAP56_PONPY
Pongo_pygmaeus
UAP56_PONPY
6
SNORD83, SNORD83
1832..1909, 6638..6713
13838
AAATCCAGGTTGAACAATAGGGCTGTTGGGGCGGGGCCAAGAACATTCTGCTCGAATTA
ACAGTATTAATGGGCCAGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTCTGGGAGGCC
GAGGCGGGTGGATCACCTGAGGTCATACATGGGTGAAGCCCCGTCTCTACTAAAAAAACA
AAAATTTGCTGGGCGTGGTGGCGGACGCCTGTAATCCTCCTAGCTACTTGGGAGGCTGAG
GCAGCAGAATCGCTTGAACCCGGGAAGCAGCGGTTGCACTCCCGCCTGGGCGACAGAGCA
AGACTCTGTCTCAAAACAAAAACAAAAACAGTATTAATGGAATGTAGTATAACCCTCAAG
CCCTATTAACACTTGGGGCCGAATCCAGACCGAGTATTCCCGCTCGGATTCAGAACACCT
TCCTGACTCACCGGCCCTAGGGCATCAGCTACCTCGGACAGCATCCTTTTGGGAAAATAC
CGCCCACCAGCCCCCACGACTGGGAAACAGTCTGGAAACACCCCTGAGCACTCCAGTTCC
CTGAGACTTCCTTCCTCCCTCCCCTCAGCTAGGGCCCGCCGTTTCCTAGTGCGTGCCCAG
CCGTCCTCAGGTCACCTTCACTGCCGGGCCAAGGACCCCGTGGGAACTCACAGCCCTCGC
CACACTCGTTCCTCGCGCATCCATGGAGGGGTGCCTAGAGAGAAGACCTGCGTGGCAAAA
ACCTAAACGAAGAGATGAGGGGCATGGAGAGGAGTAGGACAAGAGAATAAAGATAACAGT
GGGGGAGACGTTAGTTTCCTTTATACCTTTTGTTACTGGCGGTAGCAGGGGAGTTAGAAA
CGGTTTTAAAACAAATTTCAGACAGGCATTTTCCAAAGGCAAGCCTGGAGCGCACGGATC
TGTACAACCGTTGAAGGCCCTGTTTCCGGTCCCTTGCGCCTGCGCTCTTGCCGCCAAGAA
GGCGGGAGGCTGGAGTAGAGGGAAGCCTGCAACCGGAAGTGAAGGCAGATTTCCCTCCTT
CGTCGCTGTTGCTGCCGCCATACGCGCGCTCCCTGTTTAGGTAAGCTTTGGCCTTCGCTA
CAATCCGTTTCCATCTGCGCTTCTCCGCACCCATCCCGTCACATGGGTTCCTGATACCCT
TTTCACAGGCGATGGTCTGGTCGCTGGGGCCTAGTTGGTTCGCTATTTCCATAGCTTGCA
TCCCTTTCGAGAGCAAAGAGCTCCTGGGGGGAGGAAGGGAAGCTAAGGGGGGGCCCAATC
CAAGATGGTGTCCTCGGCGCCATTGTGTTCGTTTTGCTCCCTTCTTCCAATGGGTTCTTC
TCATATTGGAGGCCTCAGCATCAATGAGAGGCGGCGCTCGGCGTCCTTTGGTCTTGGTAT
TTGCGGAGGGCGGGGCTCTTCTCACCTTCCTTGTCCTTTCTTGAGCTCTTTCTCGGCCCT
CGGTGGGACTGAGAGGAGGAGCTGGTTTCTGGGCCCAGTTGGATTTTTCTCACCTTGACT
TGCCCAACTTAATTTGGAGTGCCTTCCAAGTGTTTACGATTGGTGTCATTGTATGTTTCT
CCGAAAGGAGTCTCACCTTCGTAGCGCAACGGTGATGTGAGACCACTTGGTAAAGATCCT
GTTAAAGCCTGGGCGGGGATTGCCTTTCTCTGTCAACTATTAGTTTTCTTATTGCAGGGT
GGAGACGTGAATTTTTTTTTTTTTTTTTGTGGCCGAGCCATTTGTCTTGCACCACTCCTC
CCCCCCCATGCTAATTACACAAGGCTTTCTTAAACAACGGAAGGGAGGATACTGAGAAGT
GGGAGGCTGAGAGCTATGGGAGGTGGACGGCGGCCATATGATGTTTTCTTTTCGAAAGGT
GAGCGCTTTGCGCAGTGATGACCCTCATCTATCACCCTTGACTGATGGCTGCTGAGTTAG
GCATCCATAACGGTGGGATTATAATAGGGAAGGCGCAGTCTGTCTTTGAGGACTTTTCAG
GACTCTGCTTGTCATCTCCATTTTCCACTTTACTAAGTTATTAGTCATATTTTACCTTTT
ATTATCTATTCTATTTCGTCACTGTTACTTTCAGATCAAGAATTTATAAGTTGGTCTTCC
CCTTCCAACTTTTCTGGTTTCCGCTACTGTGATTGCTAATCTTGTTGGGAACCTCTGTCC
TAACCTCTTTCCCTGTTACTGCTTTTTCTGTTCTGTTATATTTGCTTTTCGTTTTTATGT
TTTGTATCTGTTTTTCTTTCCAGGTAAAAGTTTCCTAGTTTAGGGAAAGTGGGAACTGAG
GATGGAAAAGAGGTGGTGAAGGCTGTGCTCGTGATTAAGTCTTGCTTTTTTTTTTTCCCC
CTCCAGCTCTTCTGTTAGAAATAGTATCTTTGTTTTCCTTTGCTGTTCCTCAATCCCCTA
CTCTTCACCCCTTGTTTTCACCTATTTTGCGAGAACCCATCCAGATCCCCCTTCCCTTCT
TCCCCTGCCGGCCCAGTTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTATGAA
GATGATGAGGTGGAGACAGCAGCTGGGGGAGATGGGGCTGAGGCCCCTGCCAAGAAGGAT
GTCAAGGGCTCCTATGTCTCCATCCACAGCTCTGGCTTTCGTGACTTCCTGCTCAAGCCA
GAGTTGCTCCGGGCCATTGTCGACTGTGGCTTTGAGCATCCGTCAGAAGGTAAATTTTCT
CTTGGGCATGTAGTGCTCATTGGGCTCTTTAAGGGTACAAGTTTGTCGTTGCTCAGGTGG
TGGTAAGGGTTTATACTTAAGGCTAGATCAGGGCCAGGTGCAGTGGTTCATGCCTGTAAT
CCCATTGCTTTGGGAGGCCAAGGCAGGAGGGTGATCACTTGAGCTCAAGAGTGCAGGAGA
AGCCTGGGCAACATAGGGAGACTCCAGTCTCTACAAAACGTTCAGAAATTAAGCAGGTGA
AGGTTGAGACTTCAGTGAGCCATGATTGCACCACTGTACACCAGCCAGGGCGACAGTGAG
GAAGAAAAAATCAGGAGATAAGTATCAAAAACGATTTTGGATAGAGGAGGCTTATTCAGG
CTTATTCTTCCGTGGTAGCACCAAAGTGCTAATGATCCAAAAGTAACTTCCAGGTCTGCC
ATTCATTCTTGTGACTGGCTTTTCTTGTCTGCTTATTTTAAATTTTGTCACTTGACTTCT
AATTTTAAATTTCCAGAAAGGTCCTGGTTGGACCTGTAGTCTCCCTCTGTTGGGCCAGGC
CAACTGTGATCTCTGGAAACCTCTGTGACTGGTTTAGAGATGACTGGCTTCTGGGTCAGG
TACCAAGTCCTTCATTTTGTCCAGGGTTGTAGTTATGTGACCCGAAGTATAGCAACCTAA
GTAGGAGAAATGGTCTGTGGCAGGTATTCAAATGTCATGAATTGTTACAGATTAAGAAAA
ATAAGGACAGAGCCAGGCATTGAAGGTGAGCAGTTGGTAGATGCAAGGGGTTTGTTACTA
GGACTGGGAAGGCCTAGATCTGGAGGAGGCCAAAGCTAGGAGGAATTAGGAAAGTCTGAT
TTTGAGGTGAATGTAATTGAGCAGAGAGAGGTAAAAAGGGTCTGGAAGTTGGCAAGAACC
AGGTAAATACTAGACTTTGAGAATTGAGTGGTAAGAAATGGGCTTGGCATGATGAAAAAG
GTTGTAGAGTTATCTGGAGACTGAAGTCTAATTTATCTTCCTCCCCCCCCCCCCGACTTT
TAGTCCAGCATGAGTGCATCCCTCAGGCCATTCTGGGAATGGATGTCCTGTGCCAGGCCA
AGTCGGGCATGGGAAAGACAGCAGTGTTTGTGTTGGCCACACTGCAACAGCTGGAGCCAG
TTACTGGGCAGGTATATTCGGGGAGAGTGCTGGGGAGGGGATTTTGGTTAGGACTGTAAG
GGAAGGGTGTTTTTGTCCCTAACTACTTGATGCTTTGCAAACCCATGAAACACAGACCCT
CTGTTTACCCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTATATTCGGGGGAGAGGTGCTGGGGGAGGGGGATTTTGGTAGGACTGTA
AGGGAAGGGGTGTTTTGTCCTAGCTACATGATGCTGGCAGAGCCATGAGCACAGACCTCT
GTTACCCTTGACAACCTGACAGCTGTGGGGAATGTTCTGTCGCAAGCATGGGGTTCATGA
TTTAGATCACAGAATCGAAGTCATTTATTATCGGCCCGGGTGTGTTTTTGTGACAATCAC
TTCCCTAGAGGGGATAATGAAGGGCTACACTTACCGTACGTCTCCGTCTACTTCCTGCTA
AGGTGTCTGTGCTGGTGATGTGTCACACTCGGGAGTTGGCTTTTCAGATCAGCAAGGAAT
ATGAGCGCTTCTCTAAATACATGCCCAATGTCAAGGTAAGCCAAGGTAAAGAGACCTGAG
AGTGAGGGTGTGGCAAGTTGGAGGGATAAGAAACTTGTAGGCTAATAGTCTCTTTAATTT
TGGAGAAGCTTTAGTTTGCTGTGGTTTAACAGAGTGTTGAGATCCTATGTAACAGGAGGA
TTCGTAATTGGGCTATGGATGATGCTTAACACAAGACCACCCTTTTCTTACTACTTTATA
CTGACTTTGAATCATATCAGTTTGATAATTTTGGGGTGTGTGGCAGAGAAAGCTGGAAAC
TTTAAAACAGCTCCAGTGGTGTGTGAATATTGAGGATTCTGGCCAAGTGCGCAATGGCTT
ACACCTGTAATCTCAGCAGTTTGGGAGGCCAAGGCGTGTGGGTCATTTGATGTCAGGAGT
TCAAGACCAATGTGGCCAACATGATGAAACCCACTCTACTAAAAATGCAAAAATTAGCCG
TGCTTGTTGGCACACACCTGTAGTCCCACCTACTTGGGAGGCTGAGGCAGGAGAATCACT
TGAACCCAGGAAGCAGAGGTTGTAGTGAGCTGAGATTGTGCCACTGCACTCCAGCCTGGG
TGACAGAGCGAGACTCCCATCTCAAAAAAAAAAAAAATCTGATTAAAGTTAAGCATTTTT
GGCAAGAATCCCTCATAGGTGATGCTGTATCTCCTGTTATGCCACAAATCTGGTTGACTT
ATGTTAGTTATTTTATTTTTATGTTTATTTATTTGTTTTGAGATGGAGTCTTGCTGTGTC
CCTCAGGCTGTGAGTATAGTGGCGCAATCTCAGCTCACTGCAACCTGCGCCTCCCAGGTT
CAAGCGATTCTCCCACCTCAACCCTCCGAGTAGCTGGGACTACAGTATGCCATCAGGCCC
GGCTAATTTTTGTTTTTTTAGTAGTGACAGGGTTTCACCACGTTGGCCAGGCTGGTCTCA
AACTCCTGACCTCAAGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGTG
TGAGCCACTGCACCTGGCCTCATTAATGATTTTAGATTTACCGTAGGATTAGCGTCGTGA
CAGTCTGATTCCACAGTTGTTCTTTTACCCCTTGAAACCAGAAAGTAGTTTCTGGTGTTA
TTTGATACTGTACCAAGGCTCAGATCCCCAAACAACTATTCGCCTAATGGTTTTAACATG
AAGTGATAATATTTAGCCCGAAGCAGTAATTTCATGGGGTTTGTGGGAAGGAGTTTGAGA
TTCTGGATTTATTTAGGAAAACTTAATGTTCCATGTGTTTTTTTGTGGTACTTTACACTA
ATCTGGTGATTTATTGCTGTCCTTTATTTATTTGTTTTTTATATTTTGAGTTGGAGTCTC
GCTCTGTCATCCAGGCTGGAGTACAGTGGCTCAATCTCGCCTCACTGCAATCTCCACCTC
CTGGGTTCAAGTGATTCTCCTGCCTCAGTCTCCCGGCTAATTTTTGTATTTTTTGTATTT
TAGTAAATTTTGTAAATTTTGTATTTATTTTTATTTTTTTTTTTTGAGATGGGGTATCAC
TCTTGTTGCCCAGGCTGGAGTACAATGGTGAGATCTTGGCTCACCACAACCTCTGCCTCC
CAGGTTCTCGTGCCTCAGCCTCCCGAGTAGCTGGAATTATAGGTGTGCACCACCACACCT
GGCTCCTTTATTTTTTAAATGAAGCCTGGCCTCATAAGTGAAGGAAGATGGTTAGATTAA
GTCAGTAGAACTGAATTATTGTTCTGACTGCTCCGACTAGCCATGTAACTTTAGGCAATC
ACTCTCAGTGTTTGGTGGGGGGACATAAAATTTTTAAATTAGGTGACCTCTAAAGTTCGT
TTTAGTTTGGAAACATGCTAAAAATTGGTTTAGCTCAAGCAATCCCCTGGGGGGATTGGA
CTCTTTCCTTCCTCTTTTTTGAGACTCTTTGCTCCTGGCTCGGCAGGTTGCTGTTTTTTT
TGGTGGTCTGTCTATCAAGAAGGATGAAGAGGTGCTGAAGAAGAACTGCCCGCATATCGT
CGTGGGGACTCCAGGCCGTATCCTAGCCCTGGCTCGAAATAAGAGCCTCAACCTCAAACA
CATTAAACACTTTATTTTGGATGAATGTGATAAGATGCTTGAACAGCTCGGTGAGTGGCA
GTGCTGGGGCTTGTAATGCTGGGGAGTTGTTCTTTGGAGCCAAATGATGTTTATTTGAAA
CAGGAGCACCTCAGTGCAAGGATGACTCTTATCTATCACCCATGACTGATGGCTCTGGGT
TCCTTGGTTGGTCTTTATTATGCTTTTAGCACAGTAAAGGGTGTCGTCTATCATCTTTCT
ATGATTTTTGTTTTTAACCTTTGAGAATAGGGGACTTTGATAATTTTAGGCATAAGTCAT
CACCACCACCACCGTTTTCATTATAGATTCCTATACTGGGAGTCATAGGGGAGATTCTAA
ACTGAAAGAGAAGACAGTACCCTTCTGGCATCTCCAGCACAGCATTTACAGTCAGAATTT
ATAGCTGAATAAGTGTCTAGACTCAGGTCTGGGATTAATGTAGAGAGTGTTTGTAGCAGT
TTGTGTGGTGTGGTATTCTAGTGTGCCAGATGGGGTTAATGGAAGATTTTTCTGTAAGAA
TTGAATCTTGGTGAATGAGAGGGGTTGGACATAGGCCCCATAAGTCATTACAAATGGTCT
TTGACAATTCAATATGGTGAGCTATAAAGGTGGGCTCCAGGTAGGGATGTCATATTTGCC
TGACTTGATAGAAAAGTGATCCAGAGAGTCATAAATGGACTCTGATATCTGGAATATAAT
ATGTGCTTGATATTTGTAGTCTGCTGAAGGCTGTCTGGGGCTTGGGCAGGAAAGGGTTGG
GAGAAGGGCCTGTAAAGCATGTTTTGAAGGCCTTGAGAGCCTCTGCACTGGGCTTTATCC
CCATTTCATAGTTGGGAACTTTGGGGTTTTACCTTATTTCTTGCTTGGTTAAAACAAACA
GCTGGAATCTGATCCCAATTCTTGATTCCAAGTCCATTGCTCTTTCCATTGTGTTATTAC
TATTTCCAGCAATCTTCACCTCACTGGGAAGTCTACCTCTAATCTTTGTTTATCATACCT
GCTTATTTTCTCCTACAATTTTTTTCCTTGTTCTTGTAGACATGCGTCGGGATGTCCAGG
AAATTTTTCGCATGACCCCCCACGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCA
AAGAGATCCGTCCAGTCTGCCGCAAGTTCATGCAAGATGTAAATACCCTTCTACCTTCTC
TCCCTCCACTCCCCGCCCGCTGCCTCCTCCCCTTCCTCGCCCTCTTCCTCAGACTCCCTT
GTCATTCAAGTGCCAAGAAGGCGGCTTGTGCCCAACTGGGAGTAATGACTCCTTGAAGAG
ACATACAGAAGCAGAGACAGCTAGTGTTAGGGTCTGCGCGGGTGCCAGGGAAACTCCGGA
AGACTTGGTCGGGTTAATGTGAGAGCGGGTAGTGTTCGACTTTTTCAAAAATCACAACAT
TTTTGAACCTCTTCTCCCTTCGGGGGAGGGCAGGATTTTTCTGCCCTACCACCCACGCAT
CCATCGTCTCTTACATGCCCCCTACAGCCACGCACCCTCAAGGTGGCATCGAGCATACAG
CTGGAGCCTTCTGCTCACCAAAACTCCTACTTCCCGGTGGCAGGAGAGCAAGAGAGGGAC
AGACAGATGGCAGGGCATGTCCAAAAGAAGAGCATCAGCACAAATGAATCCTCCCCTTCC
CCACCTCCAGGGGTGGGGGCCTTTGGCACCTCAATCCCCGATACCCTACTCCTTCCCACC
CACATCTCCTTGCACCCATCTGGAACCTCGGTTGATGTGAGCCGGCAACAGAGAAGCACC
GTGGCGCGGCGAGGGAATGCAGACGGCACCCAGCGGTGGATGGCGGCAGCGGAGGCCGCG
GGGAAACCTGACCAGGAAGCTGAGGACCAAACCAGCCTCTTTTTCCGTTCCCGGTTTTTT
TCCTGAACCCAACGCGTGCCGTGCCCCGTTTCCCCCAATATGTGTTGGGGAGGGGTGTCC
TGAATGGGGTGGTAGATTTTTTTTCTTAAAAAAAATTTTTTGTTTTTTTTAATACTCAGA
GGAGAGGGACATAGGAAAGGTAAAGTGGATGTAATCGGGTGGGTGTTAGGGTTTGGGGCT
AGGTGGGGCCAATTGCATAAGCAGTGGAGTGTGTTCTTCCCCTCCCTGCAGTGTTCCTTC
CCGTGGGATGATCACTCTTTGGCTGTATTTGGGGCTAGAATGAGATTTGAAGGAGGCCAT
GGAACTTCTGTTTAGAAAGCTTGCCTTGGCTGGGCCTGGTGGCTCACCTCTAATCCCAGC
GTTTTGGGAGGCCAAGGTGGGAGGATTGCTTGAGCCCAGGAATTTGAGACTAGCCGGGAC
AGTGTAGTGAGACACTCTACCAGAAAAACCGGGCGTGGTGGCGCATGCCTGTAGTCCCAG
CTACTTGGGAGGCTGAGGCAGGAGGGTTTGCTTGAGCCTGGGACGTGGAGGCGGCAGTAA
GCTGTAATTGTGCCACTGTACTCCAGCCTGGGTGATAGAGTGAGACCCTGTATCAAAACA
AAAAACCTGCCTTCTGGGATTGGGCTTCTGGTTTTTTTCCCATGACACACACATCCTTTC
CTATTTTGTCCTCTGGGTCTTCATATTAACTGTCTTCCCCCAGGATAGTATAAAAAGTGT
TAGGAAAGTTGGGCTTTGGAGTTGTGGTAATTTCTGTCTTTGTTACTTTCCTCCCCTTCA
GGGGGTTTTTTAATTTTAAAGTTGAATGCAGTGAGGTATAATGGTGTGTGCCTGTAGTCC
CAGCTATTCAGGAGACTGAAGCAGGAGGATCACTTGAGCCCAGGAATTTGAGGCTATAGT
GTGCTATGATTGTGCCAGTGAATAGCCACTGCACTCCAGCCTGGGCAACATGGTGAGATC
CTGTCCCTTAAAAGCGTATCTGCTGCTCTGAATTTGGTTTTTTAACACCACTTACTGATA
CCTTCCCTGTAAACCTGTAGATGGTTTAATTCTTAGTCAAGAGACCAGTCTCATCTAAAA
CTACCCTGTTGTGGTCTGACGGCAAGTTACTCATCTTGAGTAATTTTCGTTTCTCCTTAA
GTGGCATTTTGACTGTCCATTGCAGCATTCTGATCTTAAAAGACATCCACTTTCCTAATG
CACATGAGATTCTCTTAGTTGAAGTAGGAGAATCAAATGGAGCAGTCATCCTCCCCCCAC
CCCATGTTCTTACAAGCAACTCTGATGGAGTTATTCTGACCTTGAGTCACTGCCTCCCAT
CATTTCCCAGATGTTTGGTTCTTGCTCTCCCTTTGAGAATCATCTCCCATTTTCTTTCCT
CTCCCACCTCTATTTGAGGTAATGGCATCTGTGCCATTGGGTGGTTTCACTGCTCCTTGA
CTTCATTTGCAGTTTCTTTGCCGTGGTAGTTTTTAGTTGGGCAGTCTCAAAACTCATCTG
ATAGGAAGGAAATTAGATGCAACGTGAGAGAGACCACAGTAAAATGTGGGTATTTTTGGG
AGAGGGGTGGGGTTTTCAATCTTCTCTTTCCTCCCCATCCCCCCATGGGGTGTATTGGAG
ATCAACTTCCTCCACCCCCCCAGGTTTAACCCCCCCACTCTGCCCTCCTCCCGTTCCCCA
CCCCCTTCCTCCCCCCCAGCCAATGGAGATCTTCGTGGATGATGAGACGAAGTTGACGCT
GCATGGGTTGCAGCAGTACTACGTGAAACTGAAGGACAACGAGAAGAACCGGAAACTCTT
TGACCTTCTGGATGTCCTTGAGTTCAACCAGGTCAGTTACACGTCCAGTAGGAGGATGAG
CATTGGAGCACTCCAGCTGTAGCAGAAACCTGGATATTAAGTACACTTTTATTGAGGAAA
TCACATGTGTGATGTGGGAGAGAATGATGAGGGTATAAATATCTTAGGGGCTGAGCGTGA
GTAAGGTAGGAGCTGCTTTTCTATTCTATGGCTGGCACGGATATGTCCTCAATAACCTCA
AGGAAAATAAACTTCAACAAAAATTAAGATCCTTGGGCAGGCACGGTGGCTTATGTGTGT
AATCCCAGCACTTGGGGAGGCTGAGGCAGGTGGATCACTTGAGCCCAGGAGTTTGAGACC
AGTCTGGGCAACATGGTGAAACTTCATCACTACCAAAGAAGAAAAAAATTAGCCAGGTGT
GGTGGTGTATGCCTGTAGTCCCAGATACTCTGGTGGCTGAGGTGAGAGGATAGCTTGAGC
CCAGGAGATTGAGGGTGCAGTGAACTATGCACTACTGTGCTCCAGCTTGGGCAGTAGAGT
GAGACCTTGTCTCCAAAAGTCCTTGAAAGGTTTTAGGAAGTTGTTAAAAGTCTTGAAACG
ATTTTTGGGGGCATGTTAGGGTTCTTAATTGTTTAATTCCTCTAATAACTGCTTATTCAA
GAGAAGCATTTCTGACTGGGTGCAGGGCAGTGGCTCATGCCCATAATCGCAGTACTTTGG
GAGGCTGAGGCAGGAGCATCGCTTGAGCCCAGGACTTCAAGACCAGCCTGGGTAACATAG
GGAGATGCCCGTCTCTACAAATAGTAAAAATAAAAAAAGTAGCTGGGCGGGTGGTGTGCA
CCTGTGGTCCCAGCTACTTGGAATGCTGAGGTGGAAGGATCTCTTGAGCCCAGGAGGTGG
AGGCTGCAGTGACTTGCGATTGCACCACTGCACTCCAGTCTGGGGGACAGAGTGAGACCC
CATCTCAAAAGTGTTTAATTAATATACTTGTGAGTGGTCTATTTGCATTTAAAACTACTT
TCTAGAATTAGGGTAGCTTCCTTAGGTTTAATGTTTTGGTGAGCAGGAATATCAGTTAAC
CCCTCCAGATCTTAATTCTAGTTTTTTATCACTTTTTCATGAGGTGATCTCATCCTCGTC
TCCTACCATGTCTGGCAATTTTGATTTCTGAACTCTGTGCTACCTCAGAGGCCAGCTTCC
TTAGGGAAAAATCAGTGCTGAAATAAAGTTATATTTCCTCTTCTGCTCTAAATATATAAT
GGGGGAATAAGAGAGATGAAGAGGAATTCCTGAGAACATAATTACTAGAAACTCCCCTCT
GCCACATAATGTCTCTCACACACCATGGACCCCTATTCCCCCAATTTGCGACCCCCACCC
CCACCCCACAACAGGTGGTGATCTTTGTGAAGTCTGTGCAGCGGTGCATTGCCTTGGCCC
AGCTACTAGTGGAGCAGAACTTCCCAGCCATTGCTATCCACCGTGGGATGCCCCAGGAGG
AGAGGTGAGCTGAAGATGGGAAAGATATTTTGTGTCCTTGGGAGAAAAAGACAGTTGAGA
GAAGGGAATCTCAACATGTTTTAAATTTCCTTTCTCACAAAGGCTTTCTCGGTATCAGCA
GTTTAAAGATTTTCAACGACGAATTCTTGTGGCTACCAACCTATTTGGCCGGGGCATGGA
CATCGAGCGGGTGAACATTGCTTTTAATTATGACATGCCTGAGGATTCGGACACCTACCT
GCATCGGGTAAACCCCACAGGCTGAAGAGATCCCACTCTCCCATTCCCTTCTTTTCTATT
TGTACATCTTCATCCCTGCCTCTGGGTCTCTTTCCTCTTTGGTCTTCCAGTGCTACCCTC
TGTCTCCCTCCAGGTGGCCAGAGCAGGCCGGTTTGGCACCAAGGGCTTGGCTATCACATT
TGTATCCGATGAGAATGATGCCAAGATCCTCAATGATGTGCAGGATCGCTTTGAGGTCAA
TATTAGTGAGCTGCCTGATGAGATAGACATCTCCTCCTACAGTGAGTACTGATCTCATGA
AACTCTTTAGGTCCTCCCTGTTCCTTAGTGTGTTTGTGCTAAATCCCGTCACATAGGTCT
TGGGCACCTGATGCATAATGGACACTTGACTGGTTCATGCCCCCTGGTCTTTGATGCTGT
GTTGGGATGTTTTCCTGACCTTTATGTGGGGTTTCTGTCTTCTCTCATCATATTACATGC
CTTCCCTCACCCCCACGTCCGTCCTCAGAACCAAGGCAGTACACCAGCGTCTGCATGTGT
GCCGTGTGTTCCTGCCTCGCTTTCCCCTTTTCATGCCTTATTCTGACCATGCTACGTTTT
CTTCTCAGTTGAACAGACACGGTAGAAGACTCGCCCATTCTGGAATGTGACCGTCTGTCC
TTCAGGAGAGGACACCAGGGTGGGGGTGAAGGAGACACTACTGCCCCCACCCCTGACAGC
CCCCACCCCATGGCTTCCATCTTTTGCATCACCACCACTCCTGAACCCCCATTTCTGATT
TGTCAGAATTTTTTTTAACAAAACTAAAAATGAAACACATGTGTCTGTGGTATCTCTAAG
TGCTTCGTCCCTTTATTGTATTTGGGGTGAGGTTATTTTAGGGCATGGTCCAGGGTAAAT
TCCTATAAGGCCTGGGTGCCCTGCCTGCTGTGAGATCAAAGGGGAATGGGACTAAGACTG
CAGAGCCCTGGCTCCCCCACTACCTGCCAATTGCCAATTGCCTGTGCTTTGTGGAGGTCT
ATTCCACTTTCTCTGGCCTGGGAGACGCTGGGGTGTTTATGATGCCAAGGCTGCTGGTGG
GTTGTGCATGTATTTCTCCAGTGCCAGAGGGTGCTGTGGGCACTGGGGGAAACTTAGGCG
CCTCCTCCCAGGCTCTCTCGGTGCCTCCTCATCTGTTCCTTCAGCTTCTGAATCTTCAGC
ACCAGGGCTTGGGCCTCCCAGGCTCCCTCCTGCCCTTCCAGGAGGGCCTGGTACAGCTCC
AGCTGCTGTTCCAGCAACTCTTCAGCTTGGGCCAGCTCAGCTGTGCGGTGGGTCCCAGGG
CCCTGGTCAGGGAATTAGGGGAGGGAGCATCAGCCAGGGCAGGGGGCTGAGGCCCTGGGA
AGCTTTGTTGCAGGCTGTGGCTGGAAGTGAGAAATTCCACCTTCCCTATTCGTTTTTTGA
CCCGGTCTTTTAAGGACACCTGTGCTGAGAAGGCCAGGTAGCTCCCTGTCTTGGGCATAG
GCCTCTGGGTGGTGGCGGGGGAGCAGATAGAGTTCCCTGGCCCAGGGGCTGTAACTGGCT
GCCTTGAACAAGGATATGGGGTCACTGGAAAGAGGAACAGCCGCTCCTCCCCGCTAAGAA
ATAATTAACTGTTAGGTGAGGGGGAATAGATCCTGTTCAAGGACTTTGTGGACTGTGCTG
TTGTGGGTGGGGGTGGGGTGGGGGAAGGGAGCCCTGAGGTCTGGGCAGGGGGAGGTGGGG
AGAGGAGCTGGTAGCTGAACTAAGAAAAGAGCTGCAGGGGTAGGCATGGTGTGGGGTGGT
GCAGGGTGGGATTGAGGGTTTTTTTTCCCCACACCCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 2346..2688, 3723..3850, 4382..4474, 6406..6589, 7599..7717, 10159..10290, 11654..11763, 11862..12006, 12133..12280, 12608..12838
2478..2688, 3723..3850, 4382..4474, 6406..6589, 7599..7717, 10159..10290, 11654..11763, 11862..12006, 12133..12280, 12608..12621
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved