Pongo_pygmaeus Locus NUCL_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus NUCL_PONPY
Pongo_pygmaeus
NUCL_PONPY
2b
SNORD20, SNORA75
8250..8329, 8839..8974
10580
ACCTGCTCCCGGGCCATCTGGTGACGCTGACTTCACAGCCACCACCTTAATTGGCGCAT
TCGACCCAAATAATAACCAGGGAACCTGTGGGCGGTCAAAGGCCCGGCTCTGCGGTCTGC
CCGCCCAGGTCCCTCTCCCTGCCCTGTGAGGCCAGAAAGTTACTTCTCCGAGGCCGTTCC
CCGTGACGAGAAATATCTCCCGCTTGAGGTTCTGTGGGGTAGGGGAGGTTCGTGCATTTC
TCACAGAAAACCTCGCACAGACCCGCGACTGCCTTTATTAACAGCTCTCAGGAGGCTGCC
TGCAGCCGGGGGTGTCTCCGGCCCCATGCTCGCGGGCAAGCAGGGCTAAGCTGTGCCTCC
AAAAGGGCCAACGGGAACTCCGCGGTCCCTGAACTTCCGGCGCTGGCGGACTCCTCGCTC
CAGGGCCGCCGGGAGCCGCGGCGTGAGTGCGTGCCGGGACCGCGCGCGGGGTCTCTGAGA
AACTCCAAGCCTGCCCCAGCCTAGGGACCCAGCCACATTGGCGAACCGGAGACCGCCCGA
TTCCACCACCCCCGCGCTGCCCTCACAGCCGGCGCCAAAAACGCCAGTCCCACGACGCAG
GCTGGGACCCGCGCGCCCACGGCCCAATCAGCGCGGGCCTTGCACAAAGCGAGCCCCGCC
CCCACGGCGCTGTTGCCAGCCCCTCCCCCTCCCGTGGCCGCCTCGGCCCGCCTACTCCCC
GCCCCGCGCCGTTCACGGTTAGAGGCTCGCGATTGGCTCATGGGGACGGCCGCGAGCTTT
GGTTGGTCGGCGCGGAGTCACGAGGGCGCCGTCGTCGCCTTTCCACAGGCGATTACTGGG
CAGGCTCAGTCTTTCGCCTCAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCG
GGATCTTCAGCACCCGCGGCCGCCATCGCCGTCGCTTGGCTTCTTCTGGACTCATCTGCG
CCACTTGTCCGCTTCACACTCCGCCGCCATAAGCCGCCATCATGGTGAAGCTCGCGAAGG
TAAACGGCCTTGAGCGCGAGCGCAGACGTCGTCTAGGCCTGCTTTCCGAGGGGCGAGCGC
GGCGCCGCGGGGAGGAGGGCCTGCGCGCAGTCCCGGGCGCGTTCCAGGGCGCAAAGTGCT
GCGGGAAGTCTCGCGCGATTAGTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGA
TCTTCACCGGTAATGGGGATTCAGATGAGGGTGGTAGAATAAAGTACCGGGATTTGTAGT
ATTAAAACGCGGTTGTGCTTAAGTAAGGTAACGAAACGGGAGGAGAAATCATTTCTTCAG
GTTGACTTTTTTACCTTAGGGCAGGTTTTCTATTGGTAAAGCCTGGGAGGAAAAATGTGT
GGGCGGTTGAGAGTAGTCCCTCTTGCATTGCCATCAGGAGTAGTTTCGATGTTAGTTGTG
CTGTTTGGCACTGAGAAATGCATCTGAGGAAGGAAATGATGGTGTTTTACTATGAACAGT
AATGGCAAAATATGAATGGCCTGAAATGTCGAGGTGGAGGTGTAATGATCTACTTGTGTC
CATTTTAGGCAGGTAAAAATCAAGGTGACCCCAAGAAAATGGCTCCTCCTCCAAAGGAGG
TAGAAGAAGATAGTGAAGATGAGGAAATGTCGGAAGATGAAGAAGATGATAGCAGTGGAG
AAGAGGTAATTTTATCCAACTTAATGCAGAATTATGTTAAAACTACAAAATGGAGAGTTA
AGACATGAAATTGGATATCTGTGGCAAAAATAAGATTTTATTCATCCAGGTATGTCTTAT
TGTAGTGGTTGAGTGTTTCGCAAGCTGTTCATTGACATGGCAAGATGTCATTTGGCTAAG
TATTTGAATGTGAGTGTGAGACGAGATCTGGGGATCTCTTTTCCATGTGCCTCTGCAGGG
CTTGGAGTGTGATTTGTTGTGTTAAATCATTACATTTTTCCAGTTTCAACATGTTAGCCT
CACCCCCACATGTAGAGCTGGGCATTGTATTCAGATCTGAGGATAACCGTACCAGATTCC
TTTCCTAGCCTCCAATTAGGATTAATTGGTCTCTTAAAAAAAAAAAAAGATTAATTGGTC
TCCATTCCATTATATATAAACTTTGTAATACTACTCACTGTGTTATAGTTATCTCTGGTG
TAGATTGAGGGCTGCCACCTCTCTTTGTGTTAACATTGACCCTCTTTAGCACTCCTGGCC
TTTTATTTGCTCACTATAAAGACAGTTGAGCACTGAATTGTGCTCAGGTTTCTCGTTGAG
AACTGAATGAAAGTTTTACTCTTCCACACATTGCCTGATAAAACTACGGGATTTTAATGT
AGCTAAACGATGACTTTTATCAAACTACCATGCTCACTCTTTGATGTGTGATAGTTTTGT
AAGGAATATTTATGTTTAGCCTATTCATTTTTTGTCACAGGTCTTAAGAATTGAGCTTCA
CTGGGCTCGGTACTGCCACCCACTGTAGGAGCCCCAAATGATTTAATAAGTTAATGCTTG
GAGCCTCCTATATGTAAGGTTCTGAATAATTTACACATAGCAATTCATGATCCTTAAACA
TGTAAGGATGATACTATTACCATTTTTAGGTGAGAAAGTTGGGGTTTGGGAAAGTATGAG
GGGCAAGAATTCAGAGGGTCTGGTTCAGAGGTATTTTAAGTGTTCAAAAGGGTTCTTTAT
GTCTGGGTATTCACCTTATAATAGGGGCTCTGACTTAAGACAACATAACAGAAGCCTGGA
GTTTAACATGCTAACATGTGTCTAGTGCACGTGGTCTTGAACCAGAGGCATTGCCAGAAT
CTAACACTCATTGGGACCATGGTTATCTTTTTGGGTGTGGGGCTGGACTTACTGGTTTGG
TTTTCATTTATTGTCAAGGTTGTCATACCTCAGAAGAAAGGCAAGAAGGCTGCTGCAACC
TCAGCGAAGAAGGTGGTAGTTTCCCCAACAAAAAAGGTTGCAGTTGCCACACCAGCCAAG
AAAGCAGCTGTCACTCCAGGCAAAAAGGCAGCAGCAACACCTGCCAAGAAGACAGTTACA
CCAGCCAAAGCAGTCACCACACCTGGCAAGAAGGGAGCCACACCAGGCAAAGCGTTGGTA
GCAACTCCTGGTAAGAAGGGTGCTGCCATCCCAGCCAAGGGGGCAAAGAATGGCAAGAAT
GCCAAGAAGGAAGACAGTGATGAAGAGGAGGAGGATGACAGTGAGGAGGACGAGGATGAT
GACGAGGACGAGGATGAGGATGAAGATGAAATTGAACCAGCAGCGATGAAAGCAGCAGCT
GCTGCCCCTGCCTCAGAGGATGAGGACGATGAGGATGATGAAGATGATGAGGATGAGGAT
GATGATGAGGAAGATGGTAAGGAGTTGTCTTGGTAGTTACTGGGCTTCTGATTACAAGGT
ATCTTGAGATTCTGGGATCAACATATTCCTTCCAAGACAACCTAGAGATGAGATTAGAAT
CCTTGTGGGAATTCTCTCGGTTGTTGTGGTGTGCTAGACTTAATTACCCATGAATGATTT
TTGTGCCTCCTGAGAAAATTTCAATAGCACATTCTGTTAGTGTTTTTTATAATGTAGGAT
TTTGTTTCTAAGTGATTTTTTTTTTTTTTTTTTTTTTTTGAATGGAGCTTTTGCTGTTTC
CCAGGCTGGAGTGCAATGGCCCGCTATCTCGGCTCACTGCAGCCTCCATCTCCTGGGTTC
AAGCAGTTCTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGTGCCCACCACCACACCCT
ACTAATTTTTGTATTTTTAGTAGAGATGACGTTTCACCATGTTGGCCAGGCTGGTCTCGA
ACTTTTGACCTCAGGTGATCCACCCACCTTAGCCTCCCAAAGTGCTAGCATTACAGGCGT
GAGCCACTGCGCCCGGCCCCAAGTGATCTATTCTTGCCATGACTGTTAACTAAACATGGT
GACAGGATTGCATTTTCTTTACATTAGATTTGAAAACTGATGTTGGTTTTGGGAGATTGC
TGCAATTTTTAGGTGACTTCTCTTTCAGACTCTGAAGAAGAAGCAATGGAGACTACACCA
GCCAAAGGAAAGAAAGCTGCAAAAGTTGTTCCTGTGAAAGCCAAGAACGTGGCTGAGGAT
GAAGACGAAGAAGAGGATGATGAGGATGAGGATGACGACGACGACGACGATGATGACGAT
GAAGATGATGAGGATGAAGATGATGAGGAGGAAGAAGAGGAGGAGGAGGAAGGTACTTAA
ATTAGATTTTGACATACATTGACATGAGTTATGTTTAAAGGAGGCACTTAAGTGTTTGTG
GCTACTGATGTGTGATACATTGTTTGACATCTTGTCCAGAGCCTGTCAAAGAAGCACCTG
GAAAACGAAAGAAGGAAATGGCCAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGAAGTG
GAAGGAACTTGCAAATTAGGGAAATGGGGANNNNNNNNNNCTCTGGAAGTGCTGGGATTA
CAGGCGTGAGCCACTGTTCCCTGCCAGTAAGTTTTAATAATTTGGTGTTAGGTGGGAGAA
TCGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCAAGTTCGCGCCACCGTACTCCAGC
CTGGGCAACAGATTGAGACACCATCTCAATTTAAAATAATTGATGTTTATTTTCTTGGAA
GTACCTGAAACTATTAGACCTGTCTAGTCATAGTAAATGTTTTTATCCAGACAGGATTCT
CCTGTATTAGTGCTTACAGGTGTTCTTTTGTCAGCTGCTACTGTGAATTGTTATAAGCAG
TTTGGCTCCATGATGAAGACCTCAAATGTGAATGTGCATGTCATATCTTCGTACTGAGAC
CTTGTTCTGTAGCTACAGTTTGCAGAGCCTTGACTTTGTTTTGCTAATACTAGGGATGCT
TTTTTAAATGTGATCTTTGTTTGCACCATCACATTTGTCTAGAATACATATTGTGGATTT
TGATTTGTGTTTTCACCTGTTGTAATTTTGCCCTCCTCTCCACCTTGAAGGAAATTTGGT
TATGTGGATTTTGAATCTGCTGAAGACCTGGAGAAAGCGTTGGAACTCACTGGTTTGAAA
GTCTTTGGCAATGAAATTAAACTAGAGAAACCAAAAGGAAAAGACAGTAAGAAAGGTATG
TAAGGCTTTAGGAGATTATGCAATGAACTCAGGAGCTAGACTGCTAGGGAAAATGCTTTG
TAACCCATTTCCCTTGGTTTCTTATTTTTTTAAATCATTTTTTTCCTTTGGTTTCCTCTT
AATATGGGAATTAAATGAGCTACAGTGTTTACAAGAGTACTTGGCACTGCTTGTCAGTGT
TATAGTGTAAATTCCTGAGTTAGGCAAGCAAGAGCACTTTTACACAGAACAAGAATTATT
AGATGCACCTAAATTAATGTAAAGGGATCTTTCTTCACTGAAACTAGATTAGGTCCCTAA
TTACTGTCTATATACAGTTGTAATGTTTTAAATGGGTACGTTCACTTTTTTTGTTATGCG
CGTCTACTCTAGGTTGAACTCCAGTGTACCTAACAGATAGTTTGACATCAGCTGTGACAA
CATGGAGGGACCACTTGTGTGTTGACACTGCTGTATCTCCACATTTAGCACCGAACCTTG
TACATTATAGGATCTCAAATTATTTGTTGAATAGAGCTATGTGTGTTTTTCCCTTCTTTT
TGTTGTTGCCCCCCACCTTTGGTTTTTCAGGCCACAGAGCTCATTTTTGTTTTTTTAATC
TAGAGCGAGATGCGAGAACACTTTTGGCTAAAAATCTCCCTTACAAAGTCACTCAGGATG
AATTGAAAGAAGTGTTTGAAGATGCTGCAGAGATCAGATTAGTCAGCAAGGATGGGAAAA
GTAAAGGGTATGTTCTGTCTATTGAAATGTAAGGGTTTTATTAACATTAAGGCACTTCCC
TGCTTTATAAAAGAAATGTTGGTTTGATTTTCTTAGGCGTGTAATCTTGGACAGTTTAAC
CTGTAAATTTGTGCCTCAGTAACCCATCTGTACCATGGGGTAATGTACTCATAGGGTGAT
TTTAAAAGACAAGCTAATACATACAAAGAAGCAAGAAATGTGCCTAGCTTACAATAAATA
CTTTGTAAGTAGTAGCAGTTCTTTCAGTTAGGTGAGGTTACTATGAAAAAATTCCAGTAT
TTGTAAAACTGTAGTGGGAAGTAAGAGGGAAGCTCAAGTTTTGATTGAAAAGTGGCATAA
AACTAAGGGCATTTATTGTACTCAGATCTGAAGCAAGTTCTATGTTGCTGAGGTAAAAGC
ATTTGTGTTAATATGGTTTTAAAAACCATGAGTTCTTCTCCCTCCATTGCAGGATTGCTT
ATATTGAATTTAAGACAGAAGCTGATGCAGAGAAAACCTTTGAAGAAAAGCAGGGAACAG
AGATCGATGGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACT
ATAGAGGTGGAAAGAATAGTACTTGGAGTGGTAAGAAATTAGGCTTGTTACAAGGTTCCA
GAATTGATGGAGGGAACTCCTTTGTGTCTTCGTACTTCATAAGTTTATAAATACTTTTTA
ATCAAAGTTACTTAAATGTAGGTGAAGATCAAGGACATTACACCCCAAGTCATACTCTTA
TTTGGAATAGTAATTTCCAATCTTGAATGAGAGCTCTAAAATCATTTTGTATTGAAATAC
AGTAAGCAAATCAAGCTTCCTTTGTAGGCATGTTTTATACTTTAAATGACTTTGACCATG
TGTGTTTTGAACTCAGATTATTCTAGGAAAACAGACCAGTAGTCAGCCTATGTAAGAACA
ACCAGCAGGACATTGCAACACGTACTAAGTACTTAATATGTTGAGTAACAGAAATGGATT
TAGTTTACATCATGAGTATTTGTATATTAACTCAAGCACTGAAATTCTTAGGAATAAGGT
ATTACTGTTGTGACCGAAGCTGGGAACCACTGTTTCAGAGTCTTAGGAATGTGGTATCTC
TATTTGCAGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAG
AAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATG
GCAAATCTAAAGGGTAAGATAATTTTTCATCTTACCCTTTAGGGTAAATGATAGGGTAAA
TGATAATTTATATCATCAGTTATAGGCTATATATGTCTTAGAGGTCTAAAGGAACGTAAG
GTCATGTGATCCTGTCAGAAAAGCCAAATAATTTTAGCTGCGTAAATGAGTGTAAAATAA
AGATCATTGTTTAGGCACCAACTTGAGAGAAGGGGCTTGGCAGCGTCATGTGACAGTGAA
GGAGCATGTGCCTGGTAACTTACTCTAAGCATTAACTGTTCATCCTCAGGTATGCATTTA
TAGAGTTTGCTTCATTCGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAA
TTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAA
GCCGTAAGTTCACCTGGTTAGGGTGCTGTGGTTGGGGGTAGCACTTTGCACAAATTCTGT
GTTTCCTGTTGCTACTGAGTGAACAATAACTGGATATGATGACTGATTACCTGAGAAATA
ATTGATGAAATCTCAAGAAAATTCCTCTAGATAGTCAAGTTCTGATCCAGCTGTGTCAAC
TCAGAGCAGCAAGTTTGCCCATGATTTCCTGCCCCATCCAGTGGGCAGCACCTCCTTGGG
TTGCTTCTTCCACTTTCCATAGAAGATCTGGGGCAGTATATCAACTATGCAATGGCAATT
AAAAAATGTAAACCCAGAATAGCCTTACTTTAATTAAGGACTAGTTGGCTTAGTCGCTTT
TAACTTCTTTTTCACTAAAACAAGCATTCTTGGCTAGTAGTCATACTAGGCATTGTGCAA
ATTCGGTGTTATTATGAACTGTGACTTCACATAAAGTCACAATTTTTTTTCTTTCCCAGA
GCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAA
GGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTACTGACCGGGAAACTGGGTCCTC
CAAAGGGTAAGGGAAGGAAGCATGAGTGTTGCTTCCACTTGAAGGGGTTTTTGTTCTGTG
GAGACCTTGAGTCTAATGTGTCTTCTCATTGAGCTCCTTTCTGTCTGTCAGTGGCAGTTT
ATGGATTCGCACGAGAAGAAGAGAAAATTCACAGAACTAGCATTATTTTACCTTCTGTCT
TTACGGGGTATATTTAGCTGTTTTGTGAGACATTCTGGGGTTCAAGCTGTCACACCAGTT
AGTTTTCCATAGAGAGCTACTCTGTCACTGGTATCTTTTCCCAACTAAACAAGGCTACTT
GCTGTGGGATGGCTCCCCAGCATGTACAGTTACTCGGGACATGTGCAGTAGGTGCTTTTT
ATAATGGGCAATTTCATTTGGTGTTCTAGGTTTGGTTTTGTAGACTTCAACAGTGAGGAG
GATGCCAAAGCTGCCAAGGAGGCCATGGAAGATGGTGAAATTGATGGAAATAAAGTTACC
TTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTTGGGGGTCGTGGTGGAGGCAGAGGC
GGCTTTGGAGGACGAGGTGGTGGTAGAGGAGGCCGAGGAGGATTTGGTGGCAGAGGCCGG
GGAGGCTTTGGAGGTAAGGCACAGAGATAATGACACCACACAGCATGTGCTCTTCAGACC
CTGTGCCCTGTCACGGTTCCTAATCACTGGGGAGGAGGAGCTTTGTACCCATTCTTTTAA
CAGTGTCTTGCCTTCCTCCTGTAGGGCGAGGTGGCTTCCGAGGAGGCAGAGGAGGAGGAG
GTGACCACAAGCCACAAGGAAAGAAGACGAAGTTTGAATAGCTTCTGTCCCTCTGCTTTC
CCTTTTCCATTTGAAAGAAAGGACTCTGGGGTTTTTACTGTTACCTGATCAATGACAGAG
CCTTCTGAGGACATTCCAAGACAGTATACAGTCCTGTGGTCTCCTTGGAAATCCGTCTAG
TTAACATTTCAAGGGCAATACCTTGTTGGTTTTGACTGGATATTCATATAAACTTTTTAA
AGAGTTGAGTGATAGAGCTAACCCTTATCTGTAAGTTTTGAATTTATATTGTTTCATCCC
ATGTACAAAACCATTTTTTCCTACAAATAGTTTGGGTTTTGTTGTTTCTTTTTGTTTTTT
TGTTTTTGTTTCTTTGTTTTGCGTTCGTGGGGTTGTAAAAGAAAAGAAAGCAGAATGTTT
TATCATGGTTTTTGCTTCAGCGGCTTTAGGACAAATTAAAAGTCAACTCTGGTGCCAGAT
GTGTTACTTCCTAAAGAGTGTTTCCCCTGGAATGTCACTGGAGAGCATGGCAAAGCCAGC
TCTGCCACTTGCTTCATGCATCCCAATGGAAATGGCTTAGTGCGTGCGTTTCCAGTATCC
CAGCCCTAACTTAGTTGAAATGCTGGTGAGGGAACCTGCTCCTGCAGCCCTGGTGTTGAC
TTGAAGGCTGCTGCAGCTTCTCCCATTTTTAGCAGGTTTGAGGATTATGTCCTGAAGACG
ACTCTGAAAAGAGGTGCAGGAACACATTAGTCAGGTTTCTTAGGACAAGGAAGAGCTTCA
GGGAAGAGCAGTGGCTCACTCCTGTAATCCCAACACTTGGGGAGGCCGAGGCAGGCAGAT
CAACTGAGGTCAGGAGTTGAAGACCAGCCTGGCCAACATGGTAAAAGCCCATTTAATAAA
AATACAAAAATTAGCTGGGCATGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2168..2284, 3498..3975, 4648..4851, 4959..5002, 5005..5036, 5330..5449, 5562..5597, 5630..5754, 6363..6486, 6952..7109, 7629..7752, 8029..8162, 8639..8765, 9149..9372, 9504..9580
1001..1018, 2168..2284, 3498..3975, 4648..4851, 4959..5002, 5005..5036, 5330..5449, 5562..5597, 5630..5754, 6363..6486, 6952..7109, 7629..7752, 8029..8162, 8639..8765, 9149..9372, 9504..9577
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved