Pongo_pygmaeus Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus EEF1B2
Pongo_pygmaeus
EEF1B2
2b
SNORD51, SNORA41
2984..3062, 3333..3462
4982
AACAGAGGCGTGAGCCACTGCTAACACAACAGCGACCAATCATGCACTGTACCAGGCGT
ATAAAAATCTCGGGGGAAAGGCTCAGTTTTAAGGTCTAAGTCATCGGACACTGGTCCTCT
CCCGGGGAATAAAACGGCCTCCTCCTCTGGGAGGGAAACGTCCTGAATTTTCCCTGCAGA
GGGAAGGTTGCCTGCAAGCCTGCATTCGGGCCAGCGTTCCCGAGGACCCCCTGATCCTCA
TCTTCTTTTCTGCTTCATCAGACCAGAGACCGTGGCTAAAAGCCCCCCATCTGCCGGCTC
TCAGGGGCTTCCGAGGCGGCGGGGCGGGAGGCGGCGCCCAGTCAAGGACAAGAGAAGACT
AAGTCGCGTGGGCCAAAGGAAACAATCCCGTCAACAAATAAGCCTCTGGCCGACGCACTC
ACCCTTCCCATCCATACAAGACCTCACCTTCTCCCCGGAGCCGCGGAGGCTGTTCTGCTA
AACTGTCTGGACCACAACGACCCCCTCGGAGGCCGGGTCGCTTACTCAATATGGCGGCCT
CAGCTAACTCTGTCAGCTGGGCCTGGAGAACGGAAAGCCCGGAGGGACTAGAATCCTTGC
ATTCGACAAGTTTGTCGGCAATTTCCGTCAGCCGACCAGAGGGTGGAGCTGAGGTCGGCC
CAGTCCGGAGGCGGGAAGGACAACTTGGACCCGCAGTTCCGCCGGAAGTGGCCCCAGCCT
CGAGGCCGAGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGGCGGTTCCCGTCAACTTCGG
GAGCCGTGGAGGTATGAACTTAAGACATGCCTATTTTATTAATTTATTTCCAAACGCAAC
GAAAGGTCCATGGACAATTTGTGGGCCATTTAATTCAGAGCCCCCAGTTCGTACGTGGAG
AAGTGGGAATGCTAACGTACTTTGACCTTTAACCTTCGGTCCGGCGCGGTGGAGGGAAAC
GCCTCCGTCTCTATATAAGGAATTTTCCGGCCTCTTCGGGCCCTTTTTCCTCTCTTCAGC
GCGGGGCGCCCACAACTTGCGCGCTGTCTTTCTGCTGCTCCCCAGCTCTCAGATACAGCC
GACACCATGGGTTTCGGAGACCTGAAAAGCCCCGCCGGCCTCCAGGTGCTCAACGATTAC
CTGGCGGACAAGAGCTACATCGAGGGGTGAGCGGACGGGCTCAGTCGGGGTGGTGGGGAG
GTTTCTCCGCCCCGGGCCGGGGCCACGTGGCTCAGCGTGTCGGCTGCCGCGGGAGGGAGG
GAGGCCGGGCCCCGGGGCCCTTTCAAAGGGGAGGGGAAAGCGCCCCGTTGCGGTCTCTCA
AGGCCCTCGTGTGGGGCGATCCCGGCCTCCGGGGAGCGGTTCACGAGCAAAGAAAGGTTA
AAATGTGCTTATTTACACTTAATTCAGCCAGGTGTTTGTTTGCGCGTCGCTGCCCAATTA
ATACGTGTTAAGTTGTAGATAGAGCAACGCTTGACATTGCAGTATTTGAGGTCTACTAAG
TGGCAGACATTTCTCAGGATAGCGCGGTGACCCAAGCATAGGGTTTGATTTGAAGGAGCT
AATAAGAAAAGAAAAGCATTAAAACAACCCTACTGGGGTTAGTGCCCACTAATTAATGTG
ATGCATACAGCATTTATTATTTATTCGCTGGCGTTTGTTTTTCAAAGGTGTGTGTGAATG
TTTCTGTGTCATTGGCAGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGT
GTCCGGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTC
TTACGAAAAGGAAAAGGCCAGGTAAAATCATCTTTGTATCTAGCTGAAGAATAAGACTGC
TCTCGAAGTTTATCAGGATGTTCACATGACAAAACTGGACCCAGGCTACTTTAGTTTTGT
TGGGATATTGTAAGCTAAATTTTTCTGTAACCTTAGAAGGCCAAGAGACTGAAGCCCTCC
ATTTTTTCACAGAACAGGTAGAACATGGACAGCAGCAATTCAACTTTTCCCCACACTGCC
CTGCCAATGTGCCTCGACCTTGACCTGGGGGGCCCACCTCTGGGGTGAGAGGGTGGCTCA
TTCATTCAGTCCTTGGCCATTCTTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGT
GGACTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAATCTCAAACAGAAATGT
TCATACTGAAAGAGTAAATCATAGTGAGTATTGAAAATAATGTCTCACATGGTACTAATG
CTTGTCGGGTGAGGAGTTGAACATATGACAGTGTTTACCTGGGAGCATGTGAAAGGGTAA
ATTATGATTGCAAAAGGGATCTAGTGATAAGTAGTGATTAAAACAAGTTATTTTGTATTG
TCTGGAAAAGGATGTTATGCTAGCTCAATAGTGGTTGAATTTAAATGTTTTTCAAGCCTG
CCAGGAGTGAAGAAAGCTTTGGGCAAGTATGGTCCTGCCGATGTGGAAGACACTACAGGA
AGTGGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAG
GAGGTATGGCATCTTCTATAAAGAACTTATCGGCCAGGTGCAGTGGCTCATGCCTGTAAT
CCCAGCATGTTGGGAGGCTGAGGCGGGTGGATCACGAGGTCAGGAGTTGAAGACCAGCCT
GGCCAAGATGGTGAAACCCTGTCTGTACTAAAAATACAAAAAAATGTGGCAGGCATCTGT
AATCCCAGCTACTCAGGGGGCTAAGGCAGAGAATTGCTTGAACCTAGGAAGCGGAGGTTG
CAGTGAGTCGAGATCGTGCCACTGCATCCAGCCTGGGCGACAGAGCAAGACTCCGTCTCA
AAAAAAAAAAGAATACATCGATCAGCAATTTTATCAATGTGGTTAAGCCAATTTGCCTGG
ATTTGAATCCTGGCTTTGATTTATATGCCTTTTTCAAATTCTGACTGGTTGCATGATGAA
TAAAATCAAATCACCATCTTTCGGCTGAGTTCGTGATGGATTTGCTTTTTTCTGATTAAG
CCAGTCTTTGTGGTAACCCCACTAGCTTTAAGCAGAGGAACAACTGGCTTTCTGAAGTGG
ATACATTTTTTTTCTTTACAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGTCTT
GCACAATATGAATCAAAGAAAGCCAAAAGTAGGTCATTTGTTTTTACTTCATTTCGTGAT
AATGTAGGTAATCTTTTTCAAAGCTTGACCTTGAAGTAATTTCCTCCACATTCCTTGAAT
AGGTCAATATTTTAAAACCTCCTGTACAGGTTCTTCCACAGCTACTGGTCTGCAGCTGTT
CTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACTGTTAACACAAACACCTCT
TTCTTAGCAAAACAGAAAGTGGGTATATGTGTGACAGACACAAGATGTATCTGTAGTTTT
GTTTGGCTAAGGAGATAGTCTCAAAACAAATTGAGATGGATTTGTTTGTGTCTTGGAGTA
GGGTGAAAAAAATACAATTCATTATTTGAATAATGCTGTTTATTGTTTTTAGAACCTGCA
CTTGTTGCCAAGTCTTCCATTTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATG
GCAAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGATGGCTTAGTCTGGGGCTCATGT
GAGTTTAGGCTTTGCCTTTTTTTTTGAAACTAACATCTGGAATTTGCATACAGCTTCAAC
CTTTCTCCACAAGACTTTCTAACTAATTTTTCTTAATGCTCTTTTTAGCTAAACTAGTTC
CAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTCGAAGATGATAAAGTTG
GAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGATG
TGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGACATTTAAATAAAAGCTTG
AAAGATTACCTTTGGCTCTTGAGTATGTTATGTAGGAGGGTGGTGTATATATTCCTTTCG
TTTTGAGGGAAGGAATTAAATGAATATGTGATTCCTAAATACCACAAATTTGGTTCGGCA
TTGTTGTTGGAAAATTGCAGTGCAGGCCATGTGTGGTGGTTCATGCCTGTAATCTCAGCA
GTTTAGGAGGCCGAAGTGGGTGGATCGAGACCAGGAGGCTGATACCAGCCTGGGCAATGG
GGAGAGATTCTGTCCCTACAAAAAATACAAAAATTAGTTGGGCGTGGTCGTGCACCCCTG
TATTCCCAGCTATTTGGGAGACTGAGGTGGAAGGGTTGCTTGAGCCCAGGAGGTTGAAAC
TGCAGTGAGCCAAGGTTGTGCGACTGCACTCCAGCCTGGGTGCCAGAGCAAGGTCCTGTC
AAAAGAAAAAAAAAAAATTGTAGTGCAACTTTACCCACTTGTGATGTCCTTAGCAGTGCC
TGATGATGTGATTTGTTGTAACCTAGCATCTTCGCACTGGGAACTTGAAGATGTGAGATG
TGTGACACTACTAGAAGACACCTAACCCAGAGGAGGGAGGGCTTCCCAGAATTTGGCATG
AATTACAACTACGTAACAGGTTACAAATTTAAAATGATGACTCATGATGTAAAGAAACCG
TCTTTTAAGTGTTGGGAATGTGATTTGGAGTAGCCCTGTGTCCTGGGAGGGGGATTGTAT
AGGTAACTGGTTCCGAGGCTTCCCAGAAAAACTTGACTTTGCTGTGAAGACTCATAGGTG
CTGGGTTGTAGAGGCGGAATATTTTACTTGGATTTGGAAATCTGATTGGTTCTCATGCTG
CAGGTAAATACTGGGATGAGGGTAGTATGTTGAGTAAAGAGTAAAGTATTGGAAACTGTT
TAATCTTGACAGGGAATTTGGGGTCTGGCTAACATTTGGTATATTTTTTTTAATAGTAGT
TTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1165, 1698..1820, 2456..2582, 3141..3207, 3592..3717, 3828..3982
1086..1165, 1698..1820, 2456..2582, 3141..3207, 3592..3717, 3828..3979
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved