Pongo_pygmaeus Locus RL13A_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RL13A_PONPY
Pongo_pygmaeus
RL13A_PONPY
19
SNORD32, SNORD35
3324..3405, 4537..4622
6183
CAAAGGCCGACAGTCCAGAAAGTGAGAAGTTTCTCTGAGGAACGCTCAGTGGACTGGTG
CAGCCAGGCAACTAGAAGCCATTCCTCGAACCACTCAGAGCCCCTGGGGAAGACCACCTC
CATCTGTTTTACAGATGGAGAAACTGAGGCCCGGATAAGGCCAAGGGTTTGTCCAGGTCA
CAGTGAAGTCGACCAGACACAGGAATCCAAATCTCTAAGCCTAGAATGGGCAAGGCGCTG
GGGCTCACGCCGGTAATCCCAGCACTTTGGGAGGCCGAAACCAGAGGATCGCTTAAGCCC
AGGAGTTCGAGATCAGCCTGGCCAACATGTCAAGACTACCCCCGGTCCCGGGCCACAACA
AAATATATATATATATATATATATTAGCCAGGCATGGTGGCGTGCCCCTGTAGTCCAAGT
TACTGAAGAGGCTGAGGCAGGAGGATCCCTTGAGCCCGGGAAGTGGAGGCTGCGGTGAGC
CATGATCACCCCACAGCACTCTGGCGTGGACAACACAGCGAGACCCTGTCTCAGAAAATA
AAGTATGCCCAGACTGCGCGCGGAAGGGCGGGCCTGGCGGGTCTGGTCTCCCCATGCGGG
CCACCAGAGGCCCTGCAGCCTTCAGTCGTTTGAAGGGGTAATGGCGCTTCCCCCCACAAA
CATGGCGGACACAGCGTGTGAACGAGATGAACAGCCCCTCAAAAATATGGCCGCCGAGGC
TGGACGGCCGCTCCCCAGCAGCACCGCCTCCACGCCCCACGTGATCTCTCGCCGGGCACA
GCTCTGACCGCGGAGGTCCAACCGGAAGAATGTCCGGATTGGACATTCGGAAGAGGACCC
GCCTTCCCGTGGGGAATCTCTGCGCACGCGCAGAACGCTTTGACCAATGAAAACACAGAA
AGCGGTCTGCGCAACCGCGCTGCGTCACTTCTGCCGCCCCTGTTTCAAGGGATAAGAAAG
CCTGCGACAAGCCCTCCTCCTTTCCCAAGCTGCTGCCGAAGATGGCGGAGGTGCAGGTGC
GGGCTCCGCGCGGGCCGGGGCGGCAAGGGGCCGGGTGGGATCCAGGCCGGAATGGGGTCG
CACCCTCTCTGTACTCCTGCATGTTTTGCGGAGCTTAACATCCATAATGAAGCAAAATGG
AAGTCTTTTGGGATAAGGGGAATCTGTAGGGAATGCCGCGGCTCTGTTTAGGCCTAGGTT
GGCTACAATGCGGCATTTTCTTCTCGAGGCAAGGGTGATAGAGCTTCCAGCACAGGACAG
GTATTTTACAACTAGATTTCGCTTACCTTGAACTCGGGTAGTGGGTGGGGGCCCTGGGGT
AGAGTCTTGGCCGAAGTGGACCCTTGTGTGTCCTCAGCGATGAGGAACACGCGGAAGTGT
GGCCGGGCGGTCTCGAGGCAATGAGAAACTGAGTTTTGGCCAAAATGGAAGGTATTTTTA
TCTCGCCCAGTGCGCGGGCTACTTTGATTTCACGTGGAGGTGTGAAATCCTTGCAGCTCC
GGTGGTTTTAATTCTCAATGCCTTTCTGTGGGGGGTCGAGAGAGCTGTTGGCTGCCGGGC
ACTCGGGAGTGAACTCGTTTGCCGTGGTTTTGGGGATTGGCGATTGTCCTGAGGCGTGTT
ACTGGAAGTCGAGAGCTATGATGAATGGTTCCACAAGGCTGGGACATCTTTTGGGCCTGA
CACCTGGGGGCCCTTTCCCTGGCTCCTGGTGTAGCTACTTAAGTATAAAGGAGGGGTTGG
CTCTGGAAAGGTTTCTTTGTGAGTAGTCTGTTGTTGGGGCGGCGGACATTTCAGAGCCAG
GCCGATCTAGGCAAGTTGTGTTCACCAAACATGTGTCTTTGTGCCTAGCAACAGTTTGCA
ATGTTTCGCGTAGTTCAGTTAACCATATTCCTGAGGCAGATACTGGTATCCTTATTTTAC
AGAGGAGGAAATTAAAGCTTGGGAATTGGTGATTTTGGGCCAAGGTCACGATTTAAGGAA
GTCTGTCTGGATTTAAGAGTCTTTGTACTGACGCTGACAAAGCATGTGTAACCACCAGTG
TGTGTTTCATGCTTTTGCATTAAAACAATGAGGATTTCTACTTCTGGTGTTTTTCTGACA
CGGAGTCTCGCTGTGACACCCAGGCTGGAGTGCAGTGGTGCGATTTTGGCTCATTGCAAC
CTCTGCTTCCCGGGTTCAAGTGATTCTCCTGCCTTAGCTTCCCGAGTAGCTGGGACTGCA
GGTGCCTGCTACGACGCTTGGCTAATGTGTTTTTGGTAGAGACAGGGTTTCACCATATTG
GCCAGGATGGTCTCAAACTCCTGACCTCAAGTGATCTGCCCGCCTAGGCCTCTCAAAGTG
TTGGGATTACAGGCGTGAGCCCTTGCGCCCGGCCAGGATTTCTCCTCTTGAGGAAGCTGA
GGTTCGGTGCCTGGGCAGTTTACCGGGGAAAGCAGAGTGCTCTATAGCAGAGCTAGCATG
GGCTTTTGACTACTCTGCCTAATCTCATTCCACCTGAAATTCGGTTTTCTTCCAAATTAA
ATTTGTGGTAGAAACACTCTATACATTAGAAGAGAATTAGATTGTGTTAACATCCTACAG
TTGATTGGCCACGGTGGCTCAAGCCTGTAATCCGAGCATTTTGGAAGGCTGAGGCACGCG
GTTCACTTGAGGCGAGGAGTACAAGAGCAGCCTAGGCAACATGGCAAAACCCTGACTCAA
CAAAAGTACAAAAATTAGCTGCGTGTGGTGTGGTGGTGCACGCCTGTAGTCCCAGCTACT
CATGAGGCTGAGGTGGGAGGATAGCTTGAGCCTGGGAGGTCGACTGCCTGTGCAACAGCG
AGACCCTGTCTCAAAACCAAATCCTACAGTTTATTAGTTACAAGGTCTTGTAACTGGATA
GTCAGTGGGCAGAGCTTTGCTGGTCTTCGTTCAAATCCAATTGCTTTGCAAAATACAATC
TGAGCATAAAATCGTACTCATAGAAGAACTCAGATACGAGGGGAGTTCAGGCCTCTTAAA
CTGCTCACTCACTGATCCTGAGGCAGCGTTGCTTTCTCAGTCCCTGTTCCTCATCTGTAG
AGTGGGGCTCAGTGTATAGTTCCCAGCTCTGATGGCTAGGTGCAAGGCACCCTGTTGGCA
CGGTAGGACAAAAGAAGGGAATGCTTGCTTGTGAGGACAATCAAAGGCTGTCCTTGTCTC
TGAGCCTTTTTGCCCTTGTCTCCCACAGGTCCTGGTGCTTGATGGTCGAGGCCATCTCCT
GGGCCGCCTGGCGGCCATCGTGGCTAAACAGGTACTGCTGGGTAAGTCGCTGCTCGCGGC
CCCTCTGTCATGGGCCCCCGCTGGCGGTCAGTGATGAGCAACATTCACCATCTTTCGTTT
GAGTCTCATGGCCATGAGATCAACCCCATGCACCGCTCTGAGACCTGCCAGCCACTCTTC
CCCGGGGTTGGGGACTCCAGGCTCAAGAAGTAATTATGTATTAGGCTAAGTTTTCATTTA
AACATGAACTTAGTTCTGGCGAGTACTGCGCTGTGTCTGGAGGGTGACTGCATAGGCGGT
GGTAGAACCCTCAGGTGGCTCAGCCCTTCTAAGACTTTCCCTCCCTCTAGGCCGGAAGGT
GGTGGTCGTACGCTGCGAAGGCATCAACATTTCTGGCAATTTCTACAGAAACAAGTGTAA
GTTAAGACCTGGGAGGAGACCTGGAGAGGGTCTCCCTGTGGGGTGTTGAGGCTCTGAAAG
CAATTGCAGCCGTGTTGGGAGAGGCTACTTGGGGTTTCTGAGAAGGCCCTTGGAAGTGGG
GTTTTGGGGATGCTGGTAGACTGGGCAGGCCTCACACTCTCTCCTCTCCCTAGTGAAGTA
CCTGGCTTTCCTCCGCAAGCGGATGAACACCAACCCTTCCCGAGGCCCCTACCACTTCCG
GGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTGAGCAGAGCGTGGGGACTGCAGG
TGGTGATGGGCAGGCGGCCAGTGATGAGAACTTCTCCCACTCACATTCGAGTTTCCCGAC
CATGAGATGACTCCACATGCACTACCATCTGAGGCCACTCCATGGGCCCACCTCAGTGGG
GAGGGTGGGCGTCCTTATGAGGCCCTCTGACTGGACCTGCTATCCGTCACTCAACAGGTA
TGCTGCCCCACAAGACCAAGCGAGGCCAGGCCGCTCTGGACCGTCTCAAGGTGTTTGACG
GCATCCCACCGCCCTATGACAAGGTGAGCTGTGCCAACCCCTGCAGGCAGCGGCCTTACC
TGTGGCGTCCATGATGTTTTTGCCACAATCTACATTGTTTGATCCTCATGAAATTTTTCA
CTGGCTGAAACGCCGGCCCATTTTTTTTTTTTTTCCCTGTCTGTCCCCTCCCGGGCTCTA
AGCCCCTCTCTTTCTCTAACAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTTGT
GCGTCTGAAGCCTACAAGAAAGGTGAGTCCCAGCTTACACTGCGCCATCTACTTTGGAGA
TTTCAGGCCTGCTGAGGGACCTGGGGCCCCGGAGCCTGGCAGATGATGTCCTTATCTCAC
GATGGTCTGCGGATGTCCCTGCGGGAATGGCGACAATGCCATTGGCTTAGCTGATGCCAG
GAGGGTTGGGTGGGTTCTTTTCTAACGGGCCTGCAGAGAACAGTTGCATTATGATATGCC
CAGCTGTCAGTCACCTCCCAGCTCTCACCAGCTCCCGGCTCCTCAGGGTGTGGGGGCTTA
GATAGCCTTACAACTTCATTTGTTCACCGCTGCCGCCGCCCCCCCCCCAGTTTGCCTATC
TGGGGCGCCTGGCTCATGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCACCCTGGAGG
AGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGGTGAGGC
CAGGGGCTGGTGCTGAGGGGGGCATCTCACTCCTGGACGGGCCTGGCAGGTGCTGCCTTA
CCCACGGAGGACTCTTAACTGGCAAAGGGCCAGCCAGGGTTGGGGTGGAATGGAGTCCAT
GTAATGAGGGCAATGCAACCCCTCCTGACCACCACCACCTGCACTTATTCTTGGCAGAGG
CTACGGAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATATACAGAGGTCCTC
AAGACCCACGGACTCCTGGTCTGAGCCCAATAAAGACTGTTAATTCCTCATGCGTGGCCT
GCCCTTCCTCCATCGTCGCCCTGGAATGTGCGGGACCCAGGGGCAGCAGCAATCCAGGTG
CCACAGGCAGCCTGGGACATAGGAAGCTGGGAGCAAGGAAAGGGTCTTAGTCACTGCCTC
CCGAAGTTGCTTGAAAGCACTCGGAGAATTGTGCAGGTGTCATTTATCTATGACCAATAG
GAAGAGCAACCAGTTACTGTTAGTGAAAGGGAGCCAGAAGACTGATTGGAGGGCCCTATC
TTGTGAGTGGGGCATCTGTTGGACTTTCCACCTGGTCATATACTCTGCAGCTGTTAGAAT
GTGCAAGCACTTGGGGACAGCATGAGCTTGCTGTTGTACACAGGGTATTTCTAGAAGCAG
AAATAGACTGGGAAGATGCACAACCAAGGGGTTACAGGCATCGCCCGTGCTCCTCACCTG
TATTTTGTAATCAGAAATAAATGCTTTTAAAGAAATGTGGCGTCTTTGCACTGTGTCTGC
TGTGGAGGCAGGCCCCTGGCCAACGGGGGGTGAGGAGCTTGAAGAAGGTAGAATGGGCTG
TGCTAATACACACAATATATGTAACTTGCCCTAGATTCAATGATCCTTTCTAGACACCGT
TTACAAACCAAAGACAAAATGTGGCCAGCAGTACCTGGTGCTTCCTAGTTAATGTAAAGC
TGTCTCATTCTAATTCAGCTGCAAAGTATGGACCCATGCCCTGCTGCCAGGCTGCTATAG
TCCCGGCTGTAGAGACAAGCATTTTGCAAATGATAAGCACTAGAATAACAGGTAACGCTA
GGCTTTATGCACTAAAAGAACCCATTAGATCTGCCAGTCTGAATCCCAGAAAGGGCACTG
ATAGAGCATTTAGTACTAGGTAGCAATTTCATAAATTGTCCCTGGTCAAAGCTTGCTGGG
GCAGGCCCTGTTCCCATTTTACTGATGTCTAACAGTCGTGTTCGGTAATACGTCATACTC
GGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 3208..3280, 3590..3655, 3833..3934, 4137..4222, 4402..4461, 4790..4912, 5097..5183
1001..1015, 3208..3280, 3590..3655, 3833..3934, 4137..4222, 4402..4461, 4790..4912, 5097..5180
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved