Pongo_pygmaeus Locus NOL5A_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus NOL5A_PONPY
Pongo_pygmaeus
NOL5A_PONPY
20
SNORA51, SNORD86, SNORD56, SNORD57
3479..3610, 4497..4582, 5031..5101, 5348..5419
7798
AGTGAACTATGTACTTGGATTTTGTCAAGTAACCCAATCGCTTAACAAAATAACAATTA
AATGTATAAATGCAGTTTATAGCTATACAGCATTTTTAAAAATCCCCTTCGAATGACTCT
TTAAAATATACCAGGGGATACGCTACTTAAGTATAACTAGGTTTTGGATTTATAACGTTA
ATATTAATTATTAAAGCAAAACTCATTTCTAAAGAGTCGCCTGAGTGCCCAAAAGACGCC
CTCAAGGATAGGGAAGCAGCTCCGATTCACTCAGCGATCACCAGCGCCCAGAATTCAGGG
CCGCTCAAAAGGAGGAGCAACACGTGGCCCAGCAAAAGGAGCTGGGTCCCGTGCAGCACA
GCAACAAGAAACTGGCCTAGGAAGACGCTGGAGCGTCTTTCTTTCGCACGTCACTGCCTG
CCACCGTCATTTAAAAAAATAACAAATAAAATTAGTAGTACGAAGAAAACTGCGCGAGCT
ACGTTCGCAGCAGGGTCTGCGCCAGAGCGCGCCAGGCACCGCTCCCGTAACGGGTGGGAG
GAAAGGATGCACCGCCCACCCGGCGCCGAGGAGGCTCGTCCCCGAGTAGGGGACGGGAAC
GGCTGGGTCCCGGGGACGTGGGGCGCAGGGTCTGAGGCCACGGACGAAGCGGGAAGCCGG
CTAGGCAGCGGTCTCGGTCTGGGATGGACGCCGCGCCCCATGCGGACCTCCCGCCCCGAC
TTCACCCAGCTCTGCTGCCCGTAACTTATATGACAAGAACATCAGGAACCGGACTATCAG
CCCGAAAGGGCCTTCCCAAGTCGTTTCGCCGCCTGCAATGCCCGACCGGGGGCCGCGCGT
CCACGGCAACCGCGCCCGCCCGCGCAGCTGCATAGGCCAGAAAAGGCCTGCTCGCCCGCG
CTCGGCGCCACCCAGCCCGCGCTCCGGGCGATACCACCCCGGGCGGCCCCTCCAAAGGCC
GGAGATGGTGTCGTCCCCGGTCTCCGATTGGTCGGCGGGGCGGGGGCGTGGCCTCTGGAG
CCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCGGGCGC
CATGGTGAGAAGTGGTTGTGGGGCGCGGGCGACGCGACGGTGGGGGTTTCGACCTGGGTT
GGGGCCGCAGACAGAGCCCGGGCCTGGGCCTGGGCCTGCGCCTGCCCTGGGAGCGGGTTC
CGGCAGACGCTGAGGTTGCGTTGACGCTCGCGCCCCGGCTCCCGTTCCAGGTGCTGTTGC
ACGTGCTGTTTGAGCATGCTGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGA
TCAGTCTGCTGCAGCCGCAGGTGGGTGAGATCCGTGGGCTCCTTTGGCGGCCCCGCAGAC
CCTCATCGCGCAGGTCCCAGCATGCACCGCGCGCTCCCACGTGGCCGGCCGAGCGGTTCG
GGGCGGGGGGGCAGGCCTGGAAAGCTCTAGATCCGGGGGTCTTTACCTTGATTCATGGGT
AGAGTCGCTCTAGCAATTAGAAATAAGCCTCCCGGACTCCGTCCCCGAACGATTAAAGCA
GAAGCTGGGATGTGGGGCCCAGGTATCAGCATATTTTAAGAGCTTCCAAGGCTGACAACC
GCTGCTTTACTGCGCCGCAGAGGCAGGAGGGAGGGAAGGAAACCGCTCAGCCTCTTTCTC
CCCCCAGGTGGAGGAGTCCGTGCTCAACCTGGGCAAATTCCACAACATCGTTCGTCTGGT
GGCCTTTTGTCCCTTTGCGTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGA
AGGTAAGTCGGCCACCGCCAAGCATCACAGAGAGATGTGGTTCCTTTCGATATCCTCTCG
GGCAGCTTGTGATAGTATTTGCCGTCCTTGGCTGGCTCTGAGTCTGATAGGTGTGAGGCA
GTATTTGAGACATACAATGTGTAATTTGAAATAATTGTCTTCACAGAGCTCAAGGTCTGG
GAACTGTGCTAGACCAAACTGTTTAAAGCAGACGATGTGGGATGTGTGTTACGTTTCCTT
GTGGGCACTGTAGTGGCAAATTATTTTTTATTTTTATTTTTTTTGAGATGGAGTCTGTCC
CCCAGGCTGGAGTGCAGTGGCAAGATCTGGGCTCACTGCAACCTCTGCCTCTCTGGTTCA
GGCGATTCTCCTGCCTCAGCCTCCCGAGTAACTGGGATTACAGGCCTGTGCCAGCCACCA
TGCCCGGCTAATTTTGTATTTTTGGTAGAGACGGGGTTTCACCATGTTGGCCAAGGCTAG
TCTCGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAGTTGCTGAGATTACAG
GCACTAGCGACCGTGCCCGGCTCGACAACGGGGGGGTTTCTTAAAGGGGGTTGGCTTAAC
AGCTACTTGTGCCCGAGTTTTTGCCTAAACACAATCAAGTGTCTGGTTCTCTGCTTTCTG
TTTGATTGGAAAGGGCAGTTGGATAAACACAGGCTGAGAAAAAAAGGTTGGGTTCCAGAA
GGCAAATTCTACTAAATACTCGAGGGTGTGTTAACAAGCTATTATTTATTGCACACTTGT
GCTATCAGACCTGAATGCAATTGTTCCCATGGCTGGGCCAGGCTTTGCAGTGATGACTTG
CGAATCAAATCTGTCAATCCGCTGAGTGCAGTCACTGATGTCTCCATGTCTCTGAGCAAT
GCCTGATGGGGAGGGATCTAGGCATGCCATCCCAGCATGCTCTGTGGGACCAGGGTAGTC
AGCTGAGGGGATGTTAGAGTTGATCATCCTTCAGCCTGTTAGTGGGAACTGTGTTCTTTC
CCCTGAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACGCACCTGCCGTCCAAA
AAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCGATACAGGAGGAG
TTAGGGTACAACTGCCAGACTGGAGGCGTCATAGCTGAGATCCTGCGAGGTGAGACCATC
ATCTGTTATATTCCTGTTATCCTGGACATTTTGGGGGAGGAGGTTCTGGGAACTTGGGTG
TTTGTTGTGACTTCTGGGAAGGCCTCGGGCTTGGCCGGTGCCCATGGGTGCGGGAGCTAG
CTCAGAGCCCCTTGTTGCTCACCGTCTTGCCCTCTTCTTAGGAGTTCGTCTGCACTTCCA
CAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACA
CAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGTGTGGACAATATGATCATCCA
GTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAG
GTAAAGTGCAGGGGCCACCCGTAATACTGGAGCCTTTGGTCTGTAGTTTAGTTAATTTTG
AGTCTTGATGAGGACTGACCATCCTGTGGGTAGAACCATGTGGGCTGGGGCTGGGTCTAG
GCCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGTAG
AGTAAACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATG
GGGGAACACAGAATTGAGGAAGATTTGGATCTTTGTCCCTTTTCCTCCAGGCAGAGTAGG
TGTGGAGAGGGCAAGGCTGTAGCTCTGTGGTTTTTGATGAAGCAGCTGGGCCAGGGAGTG
ACTGTGGCTCTTTGCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATC
AACGACAATGCCACATACTGCCGTCTCGCCCAGTTTATTGGAAACCGAAGGGAACTGAAT
GAGGACAAGCTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATT
CTGGATGCCTCACGGTCCTCCATGGGTCAGTGCAGAGCCTGGCAGCCTGCATAAGGTATG
GGGCTCTAAATATCTGGCGTCTTGCATTCACACTTGGTTTTTCCTAGGCATGGACATATC
TGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATA
CCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTC
AGCCCTAATTGGGGAAGCGGTGCGTCACAGGGGATACAAAAATGGGAGAATAAGGACTGT
TGCCATGTGTACCTGCACTGTATTTCGTGACCCACCATGTCTTCCCTAGTTGTGCTTGGT
GGGGAGCAGGGCTGTCATGCAACTGGCAGGTTAGCAGTTTATTTCTCTGACTGTTTCCTT
GACTCTCTCTCCAGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGG
CCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACC
AGTGAGGGCACCTGCCCACAATCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGGGGGAT
CACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGG
CCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCAAGTCTCCAGGTCAG
CGACATTGGATGCCTTCCCTCTGCCTCTGGGAGCTATGGGTTGGCATGCATTGGGGTAGA
GATCCAATCTGGCCTGAGGCTCACTCAGGACTTCGGGGTGAGAGGAGGGGAGGAGCTGAG
CTGCCTTGGCTAATGGGGTTGAAATTTCTGATCTTAAACTCTCCACTGAATATTCTCTCA
GAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCA
TTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCA
GTATTGCCTCACGAATCGATTGCTTCTCTGGTATGGGTGGGGGGTGCTGGCAGGTGTGAG
AAGGGGCTGGGTGGCTGGGTGGATGGGTGGGGAGGCTTGCAACCATAGCTTCCACAATGA
TGGCAATATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGAGACTATGGGTCTGAGT
GAAGCTGAGGGTAGAGGGAACACAGGGTTGGAGTAGTTTGTCTCTTTGGGCTGACAGGCT
TTGTCACCCACACACACATCCAGAGGTGCCCACGAGTGTATTTGGCGAGAAGCTTCGAGA
ACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGA
TGTCATGAAGGAAGCAATGGTTCAGGTCAGTTGGGCTTTGCTGGGTGTGGAGTGGCATAG
CTAGCTGTTGGAGGTGATGAACTGTCTGAGCCTGACCTTGTAGAATGGAGGCAAAAAAAC
TGATTTAATGAGCCTGATCCAATAAAGCCAGAAAGGAGTCCTCAGAGCACCAGAGGTCTT
CAGGCCCTTTTAGCACTTTTCTTTGACCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGG
AAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTT
GCCCTTGCATCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGTCAGTAGGCAG
CACGGCTCCGGCAGAGATCCTAGGTTGTAGGATTTTCAACAGCAGAACAAAGGATGTGCT
GCATAAGCTGTGGTCTTGAGTCCAGGCTCTTGGACTGAAACAAGGACCTGAAACATCTAA
AACTACCTCTTGATTCTATAGGAAGGAGATAGGTGCTGAACTTGCTCAAGAGCCCAGAGA
GCTGGTTGTAGCTCACACCCATTCCCTGGGCATGTGTGTTCTGTCCTCGGCTGCCTCCCA
GGAGTCCTCAACCTGGGGTAGTGTAAATTCCTGCTCTGCTTATTATCAGACGTGTGTCCG
GAGGTGGTAGTGTTTCACAGTGGGGATGGGGGCAGGGAGGTCCCCAATGTGCTAAGCTAC
GTTATCCCTGAGATTTTCATTTAGCACCCAGTTTCTTAAACAGTGTTTCAGGGCCCTGCC
TGGAACTTGGCATGATGGTTCTGTTGCGACCAACATAGTGGGTGTTTCTTAAGGTTTTTT
TTTTCAATGGGCTGAGGTAATTTCTCATTACATGTTTTCCTTCTAATTTGGGACGGCCTT
TGGGGTGGATTTCTAAAGTTATACCCACACAATTAAACTATCCCAGAAACACTGGGCAAT
GTTAACTACACAGGTTCCCCTGCCTTGGCTACTTAATTGCTGAAGATGTAATGAGCACTG
TTCTCACAGCCTGTTCCCCTGTCCTTCCCTTTAGGAGACGAGTGAAAAACCCAAAAAGAA
GAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTC
TTTTTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCC
TGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAAAAAGAAGTCTTCACCCAAGGAGGA
AACAGTTAATGACCCTGAAGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATT
CTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGCTGGCAAGAGCAGCTCCAA
GAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCT
GGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAA
TAAAAACAAATTCACAAAAGTTGGTTCATGTTCTTTATTGAACACCTTACATGGATATGG
ACAGGGCCTATGGGTGGGGCAAGGCAGCAATGACAGCCTCAGTGAAGTCATGGCAAGTAG
CATAGCCACCCATGTCAGAGGTTCGAACCTGTGGGGAGAATCATCATCATCCATGTAGCC
TGGGCTCCATCCTAACAATCCCCATCACCACCCAACAGTCTGTACCCTAAGGAAGCCGGC
CCAAGGACAACCTAGGCTCTACCCAGCAAGGTGACCATGGTCTACTGCCTAGAGGCACAA
GGTCTCTTCCCTGGTGCACTGCACTGAAGGGTATGGGGAGTGTGGTCCTTCCAAGGTTGG
AAGAAATAAAGGGCTCTAGCTCCCATGGGGGTGCAGGTGACCGATGACAGACTTGATGAA
GTCGGTTGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGCACCTACAGCCACCACCGGCA
ACAGCCGTGGGGAGGGAGAAAAGAGAGCCCATGAAGGGAGGTAGGGCAATGTGATCGAGG
AAATGGAATCCAAGAATGCGTGACAGCCAGAAAAAAGAGGCAATGCACAGGAATGGAAGG
AGGAGCCAGGATGGGAAGCACATGGACCTGCCACTCCTCTTAAGCCACTATTAGCTGTGC
TGCAGCCAGGGCAGGACAGGAGGCTGAGCAGGCAAAGATGATGGGAAATGCAGATCAGAG
GCAGGATGTGGCTACTGAGCAGGCAAAGATGATGGGAAATGCAGATCAGAGGCAGGATGT
GGCTACCTTCCTTGGAAGAAATAGAGACAAGACCAGGTGGAAGGAAAGAATCGCAACGGA
AAAGAGATGGGGCGTGAAGGTGAAGCTGATGCTTCAGCCTGCCTGTATCCCTTGCTGTTC
CACCCCCAAGGAGAGCTGCAAGTTCCGCATTCAGATGGCCCATGAAAAAGGCAGTGGATG
GAGTAGGAAAGAGGGAACAGCAGATGGGATCTAAGAGGCAAAAGAGATCAAGAGGATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1083, 1250..1339, 1687..1801, 2827..2988, 3161..3359, 3737..3924, 4007..4158, 4334..4434, 4801..4949, 5183..5304, 5490..5627, 6334..6798
1081..1083, 1250..1339, 1687..1801, 2827..2988, 3161..3359, 3737..3924, 4007..4158, 4334..4434, 4801..4949, 5183..5304, 5490..5627, 6334..6696
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved