Pongo_pygmaeus Locus RL10_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RL10_PONPY
Pongo_pygmaeus
RL10_PONPY
X
SNORA70
2797..2931
4373
GGGACGCCCGCCCGCTCTGCGCACCTCTCCTGGATGCTGCCCCGTGGGCGGGTGGGGGC
GGCCCTGCTTCCCCACGACCCCCAGACGCACCCCGAGGGACTCTGAGCACAGTGAAGTGG
GAAGGGCGAGGCGGGGCGGTGCCCAGGCGAAAGCGGCTCGTGGGAGGTGGCACCCGAGAC
GCAGCTGGTCGGGACGGTACGGGTCAGTGTGGGCGGAGCGGGGCCAGTGATGCCCCCCGG
TTTCCCAGGCCATGAGTCTCCGTGGAGATTTCTCCTCGACCTCTTCCCCGCGGCAATGTG
CGAACCCTGGGTCTCCAGGAAACGGGGATACGGGGCATGGCTCCCAGCAAGGCCTGGTCC
AGTCTCTCCGGTAGGGGAATGGGTCTCCCCCTCCGGCCTCCCGGGTTGACAAAGGAACGC
GGGCCCAGGTCCCTGTATGGCGCTTCACCGCCGGGGCCTCTAGCCTAGAAGGAGGCACGG
AGCGCGTGTCCGGGACCCGTGCAAGCTCGAGGACACTCTCGCGGTCGCCGGGAGGCCCAC
CTAGGGTACTTTCCTTTTTTCCACTCTCAGAAATATACGTCTGTCACAGTTAACGGCAAA
GCCTAGGGCAAGAGTTCTACGCCCAAGATGGCCAGCCGGAAGCGGACTTCTCGCGACCAT
GTGGCGAAGCCCCATTCGTCAGCTGGCCGCCCGCGGCCCTGGTACCCGGTCACCTCTCTG
ATCTGCGCATGTGCTGGGCTACGCCCGGGCGCAAGCGCCAAGAGCGGCTGCGTCTATGGT
CATGACGTCTGACAGAGCGTCCACCCGTCTTCGCCAGGACTCTATGGTTCTTACGCGCGC
AGACAGACCGCCTATATAAGCCATGCGCAGGCGGAGGAGCGCCTCTTTCCCTTCGGTGTG
GTGAGTAAGTGTAGTTGTCGTCTCTTGTAGTGCAGCTGCTGGTTCTCACACCTTTTAGGT
CTGTTCTCGTCTTCCGTTCCGACTCTCTCTCTTTCGTTGCAGCCACTGAAGATCCTGGTG
TCGCCATGGGCCGCCGCCCCGCCCGTTGGTGAGTCTTGAATCCATGTACTTTCACTGCTG
GGAAACGGGCGGGGAAAGAAGTGCCTATGGCCGCTGAAAACAATTGTGGGGTGGAGCCTC
CCCCGTGCGGCGGCCCTGTCTTGGGAACTGACCCTATGTTTTACACCTCCCGGCTATTTT
TTAGACTGCAATAGTACTGTCCCTTAGTTCCCATGTCGGTGTGGAAGCGACGGTTTCCTT
GTATCTCTGCCTGTGTCCTGCAAGCTCACCGCATTTTCGGGCGCTCATACGGTCTTAGGG
CCTTTGTGTGCGTTCTCTGTCTTATTTCCGGGCGACGTGCCGCGTGCGTTGTCGGACGTG
AAGGGCAGCCCGGGAAAAACGGGTGCGGCCGACTCCTGTGTCCTACAGGGGGCGCCAGAC
GCATTTCCACTCTGCTCGGAGGTGGATTTAGTGCCACGTGCCCGAAAGTCTTAAATTGGG
TGACCTGAGCTGTGCAATGATAATGCGGCGATTTTGTAGTACGCAGTGTCTTGAAGAGGG
AATTTTTAACTAGGAAAGTTTGTTGCAAAGTGTTTGTAGGAAGCGTAAGACAAAGTAACG
GAAGGTGGTGGCTATTGTGTTTCTAGTTTTGGGTGTTCTCTGTGTTGCAGCAGCCAACTG
TTGCTTTGTAGTTTATTTCCCCGAATGGAAACGTTTTAGAAGTGGACGTGCATTCCCCAC
CCTTTTCCCGTCCCTCGTTTGGGTTGTTCCTTGAAGGGCAAAGTGCCTGTTGGGCTTTCT
GTGAACGTCACCTAACCTGTGTTTTTTCACTCCCCTGCAGTTACCGATATTGTAAGAACA
AGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAAGAGCCCCT
GCACTGGTTGGCTCTACTAACTCAGCGTCCGTCTGTGACACCCCCTGCACACTTACCCAA
TCCTTTTTTAGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAGAAGGCAAAAGTGGA
TGAGTTTCCGCTCTGTGGCCACATGGTATCAGATGAATATGAGCAGCTGTCCTCTGAAGG
TAAGGCAGGATTCTTTGTTCGTCACCCCCAAGTCCTTCCACCGTGCTCCCTCAACCCCAC
CCACATACACTGCACTGGAATTGGGAGTTGATGAAACATGAGCCTTACAAAACTCAGCCA
ACACATTTCCCTCGAGCTGGAGATAGTCGTGGTGAATGTTTCTCTATTATCTTCTCTCAC
TGCTGCTTTTCTTCTCCCTACCTAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTAC
ATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGAGGCTCCACCCCTTCCAC
GTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGTGAGCTTGGTCTGGG
CTTTTTAAGGCAGCTGGAGTCTCTACATTATTAGGCTTGCATTATTGCATCAGAGCATAG
AGGTGGCCCCAGTGACTCAGCCACTATGGCTACTAGAAAAGCCAGGCTGGCAAGTGACTT
TCAGTGGTCACTCAGGACCCTTTCCTGTGGACTGTTGCGGATACAAAGCAAGCATGAGTA
AGTCTTAGCAAGCTCTTCCCCACAGGTTAGGGCAAACACTTGTGATTGGAGTAGCTCTTC
TTGCTTTTAGCTTGATGACAACCATCTTGCCAGCAAGCAGGTAGTTGAAGCTGGCAGAGG
AGCTCAGTGTCGCCTTTTCAATGGTTCTTGGGATGCTCTGCAGCCAATTAAGCCGACTGA
GTTCCTTTCCTCATGGGGGCCCAGTGTGCAATGGCTGCACACAGCAGCTTCCTTGGTAGT
GTACGCAGCCTGTTGGTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTTCCGA
TGGATGTTCATGTTTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATGCGAG
GTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGT
CCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCTCTGCGCAGGGCCAAGT
TCAAGTTTCCTGGCCGCCAGAAGGTACGTAGTGCTGCAGCCCCCTTCTCCCACCTTTTTT
GCCTCAGGCCTCCTGACTCAATTCTTTCCATTGCTCCCTAGATCCACATCTCAAAGAAGT
GGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAGAAGCGGCTCA
TCCCAGATGGCTGTGGGGTCAAGTACATCCCCAATCGTGGCCCTCTGGACAAGTGGCGGG
CCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTC
TACTTCCTGTCCACCTATGTCTTTGTATCTACATTCTTGACGGGGAAGGAACTTTCTCTG
GGAACCTTTGGGTCAATTGAAGTGCTTTTCATGAAGCACAGCTGCAGCAAAGCCTTGCAA
TCCCAGGCTGGGGTCAGCCTACAATTGTGTTGCTTATTACAACACATGGGGACCAAGAGG
GGCTTGTGGGCTAGAGGCTGACCAGCAGCAACGTTTATTTAGCAAGGGTAGGTGTGCATC
ACATTGGGTTTGGTCTCACCCGTCTGGTTTGGCCATTCCTCTGGTGGGAATCATCCAGGT
ACTGCTGATGTCACCTGTAACTTGCCCGACTTCCTATCTAGCAACCTCCTGGGCCCCATG
CCCCCACCCCTTCTAGATCCTGCATTCCCAGGGCCCTCACCACCTGACCAAAGGTCTAGG
CTAACCTTTGGTACTTTGTAACAAAAAGACCTCGGAACAGACAACGTGTGTGGCATGGTT
TGGCCTGGGGATCTTAGATGTCTGACCTGAACTATTGTAGAACAGCGCTGGCTTTTGGGG
GAGCAGCAAAAATGAGGAATGCTAGGTGGGTGGCCTGAGCATCTGTATCCAGGGACAGGA
CTCCAAAGGCTTTTGGTCCCAGAGCTGGGGTATGTTGGCCCCAGCCCCCAGCCTGTGGCT
CCCAAAAGGCCTCTGGTTTTTTGTAATCTCAATTTACAGCCATTTCTTAGGTTTTTAATT
ATCTTTATTTTCTTTTGCCAAACATACCTGGGAATACCTTTTTTTTTCTACTTTGGGGTG
ATGGTTCCAAACCATAAATGTGATTATAGTTAACACATGATCCTTCTAGCGTCCCAGCCA
GTGTTTTTCCTGACCTCTTTTCTTTGGAGAGGAGGATGGAAGGGAGGGGTCCGGCACGCT
GCTGGCATTTTGCTGTGTCCTGCAGCCCCTTTACCGGGGCACCTGGGTTCACAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1047, 1840..1898, 1991..2098, 2305..2443, 2980..3142, 3221..3373
1025..1047, 1840..1898, 1991..2098, 2305..2443, 2980..3142, 3221..3370
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved