Pongo_pygmaeus Locus TRO
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus TRO
Pongo_pygmaeus
TRO
X
SNORA11
7500..7628
12533
GAAAATGGGGTCTTGAAGTCTCCTACCATTATTGTATTGCAGTCTACTTCTCCCTTCAG
ATCTATTAATATTTGTTTTATATATTTAGGTGCTTCTATGTTGGGTGCATATATTAAATA
TATTTATAATTATTAGATATTCATGATGAATTTATCTCATTATCATTATATAATGACCTT
TAAGATCTTTTATGGTTTTTGACTTGAAGTCTATTTTATTTGACATATGTATAGTTATAC
TTGCTCTCTTTTGAATGATTGAATGAATAAATAAATGCCACGAATTGTTTTCTGCATGGG
GGAACAGTGCACCATGTCACAAGAGACAGTCTAAGTACAAGTCGATATTTTTAAAACATC
AATATAGTCATTGTGGGATCAATAAAAACTTTTCATAGATTTTTATACATTACTGTTTTT
ATTCTGAATTGCATAAGATGGACGGGCACCCTATCTTTTAGTGTTTAGAACCTCTAAATG
TTTTAATGTGGTAATACTTGAAAGACAGAAATGAATATGACCTAGTCCCCTGCTCCAGAG
CAGCTCTAGGGAAGAGAGACATAGACATAAGGTATAACAACACTATGTAAATAGTGTTGG
GATAGAGGGTCTGTAGGAAGGGTTGGGTGTGGGGAGTTCAGAGAAGCACATTCCTCCTAG
GGGAAACAGGAGAATCAAATAGGGAACAGAGATACACAGTGGGGAAATAGAGAAGTCAAA
NNNNNNNNNNAGGGCTGAGGAAGGGTGTGCGGAGTCAGAGAACCTTCCTCCTAGGGGAAC
AGGAGATCAAATAGGAACAGAGATACACAGTGGGGATAGAGAATCAAATGGAGATAAGAG
GGAGTGATAACTGAATAGGGTAGTAAGCAGAAAAAGGGAGCTACACTAAGGAGAATGGAA
AGTTCAAAGTAGGTATGGAGGGGAGGAGACTGACAGGCAGGAACGGAGACCCCCCTCTGG
AGGCGGAAAGAGGCAGGACCACTTCCGGCCAGGGAGGGGGGATAGGCTCAGACACAAGGA
GAGGCTTGGAGAGAGCAGACGCCTTCTGGATTCAAGAAGACGAGGTGAGCTGAGGTGCCT
GGCTTTAGTGAAGACCCTGTGGGGGCTTCCTGGCTGCGGCTCCGACGTGCCTGACTCCAC
ACGCCCCTAAGGTTTGAAGAAAACCTGCTGGAGGTTTGGGACCTAACCGCATCAAAGTCG
CCTTTAGCGGTGCCTGGACCCAGTTCGCACGGGAGAAAGTAGGAGGCAGAATCCCCTTTG
GGCCACAGAAAGGAACGATCTGGACTCGGTTCGGGCTGTGGAAGGGAGGGATGCAGACCT
AGTTGGGACCGCAGAAAGGAAGGATCGAGAAATCCTTCAGACGGTAGCAAGAGGGGAGGA
GGATACACACAGTTCGGGAGGGAGATAGGAGACGGCAGGACTCCGTTTAGACTGAAGAAA
GGGGGCAGGACCCTGTTTGGGCCACAGAATGGAGGGATCAGGACCCAGAGAAAGGAGTGG
GCAGCATCCCTTTTGAGCAACGGAAAGGACCAGACTCAGACAGGAGAAAGGAGGGGATAT
GACCCGGTTGGTTCCGGTTTGAAAGGGAAGAGACGGGACCTGGTAGGGTTTGAGAACAGG
AATACACAGAAGGTTCATACAGTTGGATTTGGGGGTGAGGTATTCATGTTGCAGAAAGGG
CGGAGCTGCACACTTGCAGACGTGGAAAGAGGGGGGAGTGGTGTTGGTTGGGGAAGGGGT
GGTGCAGAGACGTACCGCAGAGCGGAGGGAGGGGGCTTATTAAAGGAAGGGAAGGTGAAG
AGAAATGCTGCAGAGCGGAGGCGGGGGTGTATTGGGAAGGGGCGGTGCGTGGCAGTACTG
CAGAGGAGAGATGGGCGGTGTTGGGGTAGGGGCGGTGCGGAGTGGTACTCCAGAGCGGAG
GGAGGGGGCTAGTGTTGGGGGAAGGGTTGGATCGAGATGTGATGCAGTTAGAAAGAGTAG
GTTGGGGTGGCGCCAAGATGTTCTGTTGCTCTGAGAGCAGGGGGCAGATGTGGGATTGAG
CTGATTATAAACTGACCGGTTTACCAAGGCGCATGCGCGCGGAGGGCCTTGAAGAACCGG
TTCTTTTGGGATAGAGGTGGGCCTAAGATGGGTGGGGGCGCCTCTAGTCGGTGCGCATGC
GCACTATCGAGTTGCGGAGGGGGCGTGCAAAGGGGCGGGGTCGTAGAACTGACCCTCTTG
GAGGCAAAAGGAGCTGGGCCTTGGAAACCGGATGGCCTGGGTTTTTTAGGTATGAAAACC
CAGAAGTTGAAGGGATTAGGGCCCAAGGTTACATGAGACTCCCCTAAGTCAGGATAGGTG
AGATGTCTGATGAATCTCCCCCTCCCTCTCATTCTCTATCTCAGGCCCATTCCCCTCAGG
CTCACCTGTTACTCGGCCTCCCAGAAAGATGGATAGGAGAAATGACTACGGATATAGGGT
GCCTCTATTTCAGGTGAGGCCTCTCTGCATTCTCTCTAGGCCATCTGCCCCGTCCTGAGT
TCACTTACTGCTCTTCAGACCCCTTCCACCGTGTAGTTTCATGATTCCCTGCCTAACTCG
TCTCAGTCCTCCCTTACATGGTGAAGGTGAGGAGAGGAAAACCTGCCTGACTCTATTCCT
TCCTTGCTCCCTACCCCTTCCCCTACCCCATTTTAATTAACCACTGCTCAGAGGAAGGGA
AGGCCTTTGTGGAAAGGGATGGGCTTTAGGGAGGCCAGATGGCCCAGAGGATGGTAATCC
TAAGTGTGTAGGGCCCTCTGCCTCCCCCGGGGAGCCTGGGGCTTCCCTTCCCTCCAGATA
TACAGACTGAGACCACAGAAGAAGACAGTGTCTTGCTGATGCATACCCTGTTGGCGGCAA
CCAAGGACTCCCTGGCCATGGACCCACCAGTTGTCAACCGGCCTAAGAAAAGCAAGACCA
AGAAGGCCCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAACTG
CCAATGAGATTGCCACCAACAAGCCCAAAATAACTTGGCAGGCTTTAAACCTACCAGTCA
TTACCCAGATCAGCCAGGCTTTACCTACCACTGAGTTAACCAATACTCAGGGTTCTTCAG
TCACTGCTCAGCCTAAGAAAGCCAACAAGATGAAGAGAGTTACTGCCAAGGCAGCCCAAG
GCTCCCAATCCCCAACTGGCCGTGAGGGTGGCACTACACAGCTCAAGTCACCCTTGCAGG
TCCTAAAGCTACCAGTCATCTCACAGAATATTCACGCTCCAATTGCCAATGAGTCAGCCA
GTTCCCAGGCCTTGATAACCTCTATCAAGCCTAAGAAAGCTTCCAAGGCTAAGAAGCCTG
CGAATAAGGCCATAGCTAGTGCCACCGAGGTCTCACTGGCTCCAACTGCCACCCATACAG
CTACCACCCAATGCCAAATTACCAATGAGACAGCCAGTATCCACACCACAGCAGCCTCCA
TCCGAACCAAGAAAGCCTCCAAAGCCAGGAAGACAATTGCTAAGGTCATAAATACTGACA
CTGAGCATATAGAGGCTCCACGTGTCACTGAGGCAGCTACCAGGCAGATTGAGGCCTCAG
TAGTAGCCATTAGGCCCAAAAAATCCAAGGGCAAGAAGGCTGCCAGTAGGGGCCCAAATT
CTGTCTCTGAGATCTCTGAGGCTCCACTTGCCACTCAGATGGTCACAAACCAAGCCCTGG
CAGCCACCCTGCGGGTCAAGAGAGGGTCTAGGGCTCAGAAGGCTGCCACTAAGTCTCGGG
CAACTGAAAGCCAGACTCCAAATGCTGACCAAAGGGCCCAGGCCAAGATGGCCTCTGCTG
AGACCAACGTAAGTGCCCTTGAGACTCAGGTTGCTGCTGCTGTCCAGGCCCTGGCAGATG
ACTATCTGGCTCAGTTGAGCCTGGAGCCCACAACCAGGACCCGGGGCAAGAGAAACCGAA
AGGTGAGATCTCTGACATTGCCATCCTTAACTTTGTGCTTTTTTTCCATTTCTACCCTTC
TAGTTTGTTCATTTCTTCTATAAAAGTTTTACTTTGAGCTAGTTCCTGTGTTCAGATAGG
CTGTGGAAGATGCTGAGAAGAAGGTGATATAGTTTCTGCCCCCTAGCAGTTCACAGATTG
GTGAGGAAATAAGACATCCATACACTCAGCTACAACCTGTATGTAATACTACTTGTATTT
AAATAGTAGTTACCACGTGCCAGGCTTTGTGTTGGGTACATTTACACAGGGTATGTCTGA
ATGTCTTGAAAGTAACTCTTACCAACAAGGATCATAGGTCCCAGTTTTACACTTAAGAAA
ACTGAGTCCCAGAGAAATGAAGTGACTTGTCCAAGAGGTACCAGCCAGCATAACTGGTGG
TAGCCAAAGGAAGAGAAAGACCCTTAGGCTCTTATCTTGAGTTGTTCCTGGCCTGGCAGA
GGAATGAAACTCCTTCCTGGAAGACAGTGAAAGATAAGCTCAGGACTCAGGGTGGCCAAT
GGCAAGGTCAGGATCAGGCTCCACTACAGCAAGGCTGAGGGAGGGGGTTAGAGGGACTTT
CTGTCTAGAGCAGGCAGGCAAGGTGAGGAGACAGAACCATCTCTTTCACCTGGTGACTCT
GGACCTTCTTCTTTCTGATGATGAAGTCCAAGCATCTGAATGGGGATGAGAGAAGTGGCA
GTAATTACAGGCGGATCCCATGGGGCCGGAGGCCTGCGCCACCGCGAGATGTGGCCATTT
TACAAGAAAGGGTAAGAATCCAATGCTGTCCAGTCTTTTCTCTTCTTCACCTGCCCTCTT
CTCTGCCACCTTCCAAGTTTTCTGCAAGCATGTTAAGATCGTTCCATCTATTCCTGTCCT
CCCAGGCTAATAAGTTGGTGAAATACCTGTTGGTTAAGGACCAGACAAAGATCCCCATCA
AACGCTCAGGTAGTGTCCTACCAACCCTCCTCCTTGAGCTCTCCTCTCCAATCCCCTCTC
CTCCCATAGTCTGGGAGTAACACTTTATGGCCTCTTTGTTCTGTCATATCTCCACACCTG
CCCTCCTTGCACTCTGCCATGGCTGGCATCTCCCATTAACTCACTTCAGGTCTCTGATTG
CACTGACCCAACAGGACTGGCAAAAGGGCTGCAGCTCTGTGGCCCCTGCTAAGCTCAGCT
ACTCTCACCTCTCCTTTTCTACAGACATGCTGAGGGATGTCATCCAAGAATATGATGAAT
ATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGGTGACGGGGCAGTGCT
GGTGGATGGGCGCAATGGGGAAGCTTTGAATCGAGCAAAGACATACATGTCCCTTTTGGA
GAGAATCAAAGAGACATGCTAATCCAGCCCCATTACGGTGTGAATGGGCAGACAGTGGCC
TAGGGAGAGGTGTAGACTTGCCATGGGTCACACAGCATGTCAGTGATGAAAGCATGGCTA
GGACAGAAGCCACTCAAATTAGTCTCAGCTTCTATTCATAGTTGGACACATTCTGCATGT
ATTTCAGATCTCACCTCTCCCTTGTATCCCCATTCTCTGTCTCCCTAGATTCCTGCTCAT
CACAAAGATGATGTTGATGACAATAGTACATTTGCTGCTTGTTTACTGGTTGCCAGGCAC
TTGGCTATGTGCTTTATGTGCATTATCTCACTGATTTCTTACACATGCAAACCCCCTAAG
TACACTGGGAGTTTTAGGAAGCCCGGAAAGTTCACTGATACCTAAGCTGAATTTTGTGAT
CTCACAGGCTATTCTTTTACTTGGCAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAG
CAAAGTAGCTTGTATATTCTCATCAGCACTCGGGAATCCTCTGCAGGCATACTGGGAACG
TAAGCTGGGAAAGGGCTGGAGTGGGAAGGAAGCTTCTGCTTTTATCTGTGCTGCTACCCC
TTCTTTGTCCTACTTCCCCCATCCTCTTAGAGAGTCGGGAAAAACAGGGTCTCAAAAGCC
CTGTCTCAGCACCTGCACATAGTTGGAGCCCTGCTCACAGTAGTGGCACCTGATTATGAT
TGACTGAAGGGTATAGGAGCCTAGGGTGGGACATTCCTGCTGTCAGGTTTGCTGTCTCTG
TAGAAGCTTTCCAGGAAAGCAGGCCTGTCATTGCTTGCCTCTTCCTACTGGGTGCCTGGC
CTGGCTTTGGCAGAGTGGTTCTTAAGGAGGGCTTCCTGGTGTGGATGGATCAGGATGCAT
GAAGCGCGGGAGTGTCAGTGGGGCTGAAGGTGCTGGGAGAGAAAGAAGGGACTCACGTTG
ACTGAGTGCTTGTGTTGTACCAGGTTGACAGCCATTCTTCCATCTTCTTGGCAACCTGAA
GAAGGGAGAATATGATTTTCCCATTTTACTGAATAATAGACCAAGGCTTGCAAGGTCTAA
GTGCCTTGCCCAGGGTGGTATAGAGCTGGAAGCAGAGACTGGGCAGAATTCTGTATCTGA
GGAATCTGGGAGAGGTTGGCCTGGTGAGCTGGCTGGTGTGTCTCTTGCGGATGGCTGCTG
AAACATAAACCTTCTTTCTGTCCTGTTGAAACATAAACCTTCTTTCTGTCCTGTTATTCC
CTTAGGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTT
ATGAATGGCAACAAGGCCAGTGAGGGTGAGTGGCTGGGCATGCAGCTGAATGGGCGGCCA
TGGTCTGGATTCCATGTGTTCAATTTCTGTCCCTGTCTCCTCTTCCCTCTCCTCGCAGCT
GTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTATGACTGGGCTCTCTCA
GCGCTTGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGATGGTCCTAGGATTGCATCAGTCT
GGTGGTCTGGTGGAGTGGGTGGGGTGCTGGACTGGGTAGAGGGCCCAGGGTTCTGACCTG
GGTGGATGATGGGCAAATGGTCCTGAACTCTCTGCTGTCTCTCTCCTTTATGTCCTCTGT
CTGTTCTAAGCTGAGGCGTTAGATAGACCTTCAGGGATCCCTGACAAAGAGGCATCTGGT
CTTAACTGCTTGCTTCTAGTGGCCATGTGCTCACTACTTTCTTTGCTTCATTGAGACTGC
CCCATGTGCTACAGAGGTCTCTTCCATGTTGGGAAATGCCTCTGCCCTCATCTGGGCAGT
TCTGATCTGTGTTCATGGGTTATTTTTCCCATTGTCAGGGTGAGGCATTCACTCTTTGGG
GAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTAAGTGGTGTTTGGGGCT
TTGTCTGGCCCTGAAGTGTTCTGGGTATACTGATCTGGTTCAGAAAGTGCTTAGTCAGTG
CCTTTCTTATACTAGCTTTAGAGGGATGGGCATCCTGTGTCCTAGAACTGATACTGTCTA
AAATTCCCATGGGCAGACCTTTCCAGGACTGGGCCAGACTCAACACAGGGCCCTTGCAGT
GGGGTGCGCTCAGAGCAGAGGGCCTTAAGAATGGCTCCTCTGTTTACAACACACCCAATA
GGAATCTGGGCTTACTCCTCACAGGTGGCATGATACTTTGGCCTTCCTGTGACATCATGC
CCTATACATGTCTCCCCTGGAGAAGCCCAAGGGACTGCTTTGCACAGGGCGAGTGGGAAA
TGGCTCAGTATTGGAGGCCAAGACCATAAAATGTGTTTGGTAATGAGTCTGGGGCTGGAG
GGTCTTAGAAATCCTTCTCCAGGGGCTGTTTATATTTGTTTGGAGGAGGTTGCCACCTGG
TGTCTAGTGCTTAGACAGCAGGCTTGCTTGGTTAGAAACAAGTTTCATTTCCTTTTTCCA
AGGTACCTGGAGTACAAGAGGGTCCCTAACAGCAGACCACCTGAATATGAGTTCTTCTGG
GGCTTGCGCTCCTACCATGAGACTAGCAAGATGAAAGTCCTCAAGTTTGCATGCAAGGTA
AGAGGAGAGCTGCCCGAGCTTGGCATGTTAAGGCAATGGGATACCCTTGGCTGAGGCAGG
CAATGCACAGGGATGGGCAGGTACAGAGCAGCCTGCAGCTCATATATAAATATGTGGAGC
CTCCTTTATGTCCTAGGGTGCTGCTAGATATATAGTTTACATCATCTCATTCATTCTTCA
TACTTTGTATTAATCAGCATGGGCTGCCATAACAAAATACCATAGACTGGGTGGATTAAA
AAACAAATTTATTTTCTCATAGTTCTTGAGGGCGAGAATCCTAGGTCAGGGTCCACCAGG
GTCAGTTCCTGGTGAAGGCTCTCTTCCTGGCTTGCAGATGGCTGCCTTCTTGCTGTGTCC
TCACAAGGCTTTGTGTGTGAGAGAGAAGAGAGCAAGCTTTCTGGTGTCTCTTCTTATAAG
GACACTAATCCTGTTGATCAGGACCCCACCCTTATGGCCTCATTTAACCTTAATTATCTC
CATAAAGGCCCTATCTCCAAATACAATCACACTGGGTGTTAGGGATTCAACATATGAATT
TGGGGGCGGGCACAACCCTTCAGTTCATAACATATTTACTCTCTATCATTTCCCATAATT
ATAAAGACACTTAGGCTAAGTGAGGTTAAGTAACTTGTCCAAGGTCATATAGCACGTAAG
TCATCAGAGCTGAAACTGGAGTTCAGAACTGACCCATGATAGAGCCCCAATAACTAAGAA
TTTTAAAAAAGTATTGCTACCAGTTTAATACAAAGCCCATAGGTTAATACGTGATTACTA
GGGTTGTTTTCTTATTATGATTATCATCCCCATTTCAGGTGCAGAAGAAAGACCCCAAGG
ACTGGGCTGTGCAGTACCGCGAGGCAGTGGAGATGGAAGTCCAAGCTGCAGCTGTGGCTG
TGGCTGAGGCTGAAGCCAGGGCTGAGGCAAGAGCCCAAATGGGGATTGGAGAGGAAGCTG
TGGCTGGGCCCTGGAATTGGGATGACATGGATATCGACTGCCTGACAAGGGAAGAGTTAG
GCGATGATGCTCAGGCCTGGAGCAGATTTTCATTTGAAATTGAGGCCAGAGCCCAAGAAA
ATGCAGATGGCAGCACCAACGTCAACTTCAGCAGAGGAGCTAGTACCAGGGCTGGCTTCA
GCGATGGTGCTAGTATTAGCTTCAATGGTGCACCCAGCTCCAGTGGTGGCTTCAGTGGTG
GACCTGGCATTACCTTTGGTGTTGCACCCAGCACCAGTGCCAGCTTCAGCAATACAGCCA
GCATTAGCTTTGGTGGCACACTGAGCACTAGCTCCAGCTTCAGCAGTGCAGCCAGCATCA
GCTTTGGTGGTGCACCCAGCACCAGCACTAGTTTCAGCAGTGAAGCCAGCATTAGCTTTG
GTGGCATGCCTTGTACCAGTGCCAGCTTTAGTGGTGGAGTCAGCTCTAGTTTTAGTGGTC
CACTCAGCACCAGTGCCACTTTCAGTGGTGGCGCCAGCTCTGGCTTTGGAGGCACACTCA
ACACCACGGCTGGCTTTAGTGGTGTACTCAGCACTAGCACCAGCTTTGGCAGTGCACCCA
CAACGAGCACAGTCTTCAGTAGTGCGCTTAGCACCAGCACTGGCTTTGGAGGCATACTCA
GCACCAGTGTCTGTTTCGGTGGCTCTCCCAGCTCCAGTGGTAGCTTTGGTGGTACACTCA
GTACCAGTATCTGCTTTGGTGGCTCTCCCTGCACCAGCACTGGCTTTGGAGGCACACTCA
GCACCAGTGTCTCCTTTGGTGGCTCTTCCAGCACCAGTGCCAATTTTGGTGGTACACTAA
GTACCAGCATCTGCTTTGATGGCTCTCCCAGCACTGGTGCTGGCTTTGGTGGTGCTCTCA
ACACCAGTGCCAGCTTTGGCAGTGCGCTCAACACCAATACTGGTTTTGGTGGTGCTATGA
GCACCAGTGCTGACTTTGGCGGTACATTAAGCACCAGTGTCTGCTTTGGTGGCTCTCCTG
GCACCAGTGTCAGCTTTGGCAGTGCACTCAACACCAATGCCGGTTTTGGTGGTGCTGTCA
GCACCAGCACTGACTTTGGTGGTACACTAAGCACCAGCATCTGTTTTGGTGGCTCTCCCA
GCACCAGTGCTGGCTTTGGTGGTGCACTCAACACCAATGCCAGCTTTGGCTGTGCCGTCA
GCACCAGTGCCAGCTTCAGTGGTGCTGTCAGCACCAGTGCCGGCTTCAGTGGTGCACCAA
GCACCAACCCTGGCTTTGGCGGTGCATTTAGCACCAGTGCTGGCTTCGGTGGGGCACTTA
GTACCGCTACTGACTTCGGTGGTACTCCCAGCAACAGCATTGGCTTTGGTGCTGCTCCCA
GCACCAGTGTCAGCTTTGGTGGTGCTCATGGCACCAGCCTCTGTTTTGGTGGCGCTCCCA
GCACCAGCCTCTGCTTTGGCAGTGCATCTAATACTAACCTATGCTTTGGTGGCCCTCCTA
GCACCAGTGCCTGCTTTAGTGGTGCTACCAGCCCTAGTTTTTGTGATGGACCCAGCACCA
GTACCGGTTTCAGCTTTGGCAATGGGTTAAGCACCAGTGCTGGACTTGGTGGTGGACTGA
ATACCAGTGCTGGCTTTGGTGGTGGCCTAGGCACCAGTGCTGGCTTCAGTGGTGGCCTAA
GCACCAGTTCTGGCTTTGATGGTGGGCTAGGTACCAGCGCTGGCTTCGGTGGAGGACCAG
GCACCAGCGCTGGCTTCGGTGGTGGACTGGGCACCAGTGCTGGCTTCAGTGGCGGACTGG
GCACCAGTGCTGGCTTTGGTGGTGGACTGGTCACTAGTGATGGCTTTGGTGGTGGACTGG
GCACCAATGCTAGTTTCGGCAGCACACTTGGCACCGGTGCTGGCTTTAGTGGTGGCCTCA
GCACCAGCGATGGCTTTGGCAGTAGGCCTAATGCCAGCTTCGACAGAGGACTGAGTACCA
TCATTGGCTTTGGCAGTGGTTCCAACACCAGCACTGGCTTTACTGGCGAACCCAGCACCA
GCACGGGCTTCAATAGTGGACCCAGTTCTATTGTTGGCTTCAGCGGTGGACCAAGCACTG
GTGTTGGCTTCTGCAGTGGACCAAGCACCAGTGGCTTCAGCGGTGGACCGAGCACAGGAG
CTGGCTTCGGCGGTGGACCAAACACTGGTGCTGGCTTTGGTGGTGGACCGAGCACCAGTG
CTGGCTTTGGCAGTGGAGCCGCCAGTCTTGGTGCCTGTGGCTTCTCCTATGGCTAGTGAG
GTTTCAGGTAACTGCAATATTTCCATAGCCAGGACCCACAGGGATGGGTATAAGAGCTGG
GAGATGTTATAAGAAACACTAAGGCAGGAGAGCAGGGTGGAAAGGTGAGGGCAATTAAGG
AATTATGAGAAGACAGTGTATTTGGTGCTAAAATATGTTCCTATTTGTTTTGTTTTCAGG
TTTATTCCCCATGTTTATAGATACCGCTAATAAATTGCAGTAGTCCTTCCTGTGGAGCCA
AAGTACATCCTTGGAATCTTTGTCCACACAACAGTCAAGGCAGCTATGGCCAATCAGCTG
AGGGTGTCATGTGATGGAAAAATCTGTTTGCTGTTCCTGCTTTATTGTTTGCTTTCTGTG
TGCTGTCATATTTTGGTATCAGAGTTACATTAAATTTGCAAAATGAATTGGAGTTTTTTC
TTTTAATGTGCTTAGGTAGTTGTGGAGTGGCATCTTGGGTTTGTAGAAGAGCTGGAGATC
AGCATAGCTCTTTGGAGAATGTGGGGCTCCAGCTTTTGGCTCAAAGGCAAATACAACTTC
AGCAGGATAGAGGCCTGGGGAAAGCATGGCAGGCAAGAGGATAACAGCTTGAGGAAAGAT
ATGGAGAGGGAAAGCCTGGAGCAGAAGGCAAACGGAGAGGCTTCTGGACAGTAAGTACAG
ATTCATTTTGAATCACTGGTGTAAGAATGGAGGGAAGGGCAGAGGTCACTAGGGGTGGAC
ATAAGAACAAGGGAGGGTTTAATTGGGATAGGAGAGGAAAACTTGGGCATATTGTATAGA
CTGTGGGGCAAAAGCTAACAGGAGATTATATGGGAACAGGAGATTGATATGGAAGAGTCA
GGAATTGACTGAAGTAGCCCATCCCTGAGAAGGTGGGATGGAACAGGGTACCAGAGAAGA
CGACCCTGACTTTGAACAGACTTAAGGGTGGCTGTGGATGCAGATAAATATAGATCTGCT
TCAAGCAGGGATCAGCAACTTCTGTAGTAGACAACAACAACAAAAAAAAGGAGAGGTGGA
TTATACAAGGTTTAGGTCTTGCTGGGTGGTTGTGATGGAAGGACAAGGGAACAAAGGCAG
CAAGTGTATGAGTCTGTCTCTTTACCACTGGGTCACTGGTACCTGGCTTATGGTAGCTGC
ATGGAGAGTGGCTAAAGAGATGGCCCATAGTATCCAACATAGTTAGGGACAGAACACTAA
GGATAGATTGGGGGACAATAGAGCATTCAAAGAACTCTGCTCTTGATGCTGTACAGCAAC
AAATATTGTTCATTCAAAAAATACTATAGGGCTGGGCACAGTGGCTCATATCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 2399..2472, 2771..3961, 4646..4750, 4865..4928, 5184..5263, 5787..5878, 6605..6684, 6778..6820, 7238..7300, 7862..7976, 8798..8905, 11399..11416, 11420..11533
2428..2472, 2771..3961, 4646..4750, 4865..4928, 5184..5263, 5787..5878, 6605..6684, 6778..6820, 7238..7300, 7862..7976, 8798..8905, 11399..11416, 11420..11530
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved