Pongo_pygmaeus Locus MAGD2_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus MAGD2_PONPY
Pongo_pygmaeus
MAGD2_PONPY
X
SNORA11
7627..7754
9952
GAAAAATGGATATATTTGACTATATAATAATTAAACATTTTTGTTTGGCAAAAGTTATC
ATAAATAACATGAAAAATATTTGTAATATGTGACACGTACAGGAGAGACATTGCTGGTGG
GAATGTTATTCCATGTACTTTTTAGGAGTAAGTTGACAAATTTTGCATCAAAATGGAAGA
CTTTTTTGTAGCATTTGAGCTAGCAAAAAATACCATAAAAAAAAGTGCCCCCAAACAATC
TAAATGTACATGTGTACTGGACTGGTTCAATAAATTATGGGACATCTATGCAAGAAAAGA
TCATGCAGCTGTTTAGAAAAATGTGCACTGACGGAAAGATGTTTTTATATATAACTTGGA
AAAACAACAGGTAGCAAAACNNNNNNNNNNTTTGTAGCATTGAGCAGCAAAAATACCATA
AAAAAAGGGCCCCAACAATTTAAAGGACCTGTGTACTGGACTGGTTCAATAAATTATGGG
ACATCTATCAAGAAAGATCATGCAGCTGTTTAGAAAAATGTGCACTGACGGAAAGATGTT
TTATATATAACTGGAAAAAAACAGGTAGCAGAACAGAAGGTATGTATAGTGTACCATTTG
TCGGAGAGAGAACCTGAATAATTAGTATACAAATAGAAAAAAAATCTGGAGAGCAAAATG
TTAATAGTGGTTATTTCTGGGAGATGAGTGGCCTTTCATTGGTGTGTTATATATTACTGT
ATTGTTTGAATTTTTACAACAACAACAACAAAACAACAACATATTACCTTTGTAATAAGA
AAAAATGAAGATATAAAAATAAATTCAATGAATGACTTGCTTTCAGGGGGCGGTTTGGGT
TGGAAGAGCTTCAGACTGAGCCTGGTACAGTGGCATAAACATGGGCTTTGGCGTCAGACA
GCCCTGAGCGGGGCCCCATTGCCCCACCCCCGAGGAAGGCGAGGGGGGGTGGCAGGGGGC
TGCGGAAAGGGGCTGGGCTGGGTTGGGCTGTCTGCAGCTCTAGTCCAGGAGGCTGAGACT
TCGAGAGGGACTTAGAGAAGGCAGACGCATCCCGAACTCGCTGGAGGACAAGGTGAGGGG
CGTTGAGAATGGGGTTTATGGAGGTCAGAGAGTGGTTTCAGACCCCTCGAACCCATAGCC
AGGCAGATGAGCAATTCTTACTGCACCACTGCAGCTGAAGCAGAGGTGACCTGGAGTGGG
GTGTAGGCAATGAGGACGACCGAGAAAGTAGTAGGCTGTACAGACTGGGAGCAGAGACTA
GCGGAGGGAGGAGGGGAGAAAAACGGGGAACCAGGAATGTTGGGAGGGGGACGAGGAATA
CAAGGAGGAAGGGGAACACTGAGGGGGAGTGAAGATCCAGAGAAGAGAATCGGGGATGCA
GAGAGGGGTTAAGGAATACTGAGGGGCAGGGTGTGCAAACGTAACACGGAGGAGGATGTA
AGGAATGGGAAGAAGGAATTCTGGAGTAAATAGGAAATGTGAGGTAGGAATAGGGAGTAG
GGAGCCAGGCTAAGGGAATACGGAGGGGGGCATAAGGAATGAGGAGTAGGGCGCGGGGGA
GGGGCAGACAGGCTGGGACGGAGGCCCCCTAGGGAGGCGGAAAGGGGCGGGACCACTTCC
GGCCTAGAGAGGGGAGGGCGGTCTCCGAGTTTCGGAGGGGCTTGGAGTGAGTGGACGCAC
TCGGGAATTGTAGGAGGACGAGGTGAGCAGCCGGGCCGGCTTTTGGATGGGAGCCCCGCT
AGGGGTCGGCCCCACCCTCTGGGATCTGGAGAAAACCTGCCATAAGGACCGGATCGTACC
GGATCCATCCGGCTGGGAAGGGAGGGGACTGGACCCGGTTTGGCCGGGCCCAAGATGGAA
TCACTAGCTCAATATTTATTTGAGGAGGGGGTGTAATAGGGAAGGGGCGGAACCAAGATG
CGCCTGTCTGGAGGGGGGCGTGTTAGGAAGAAGGGCGGGGCCAAGAGACACTGGACTCGG
TAGGGCGTGAGTAGGAGAGGGGCCGGGCCCACCAGACACTGCGACAATTTTGGAGGAAGG
CTTGTTGGGCAGGGGGCGGGACCGAATGGTACTGCGGACCTGGAGTGGGGCGTGTGTCGG
GGCAGAGTGCCAGACTGAGACCACGACCATTGCGCATGCGCACTATGTTTCGCTAGAAAG
GGGCGTGTTGAGAAGGGCTAGCACCGAGAAGAGCGAGCTGCTGAATGCGCATGTGCACGG
TGGACATCAAAGAAAGGGCTCGTGCTGGGAAAGCGGGCGGGGCTGAGATCGGCCCTGCAG
CCGACGCGCATGCGCTCTATCGACCTGCGGCTGGGTGGGGGGTGCACTGGGAAAAGGGGC
GGGGTCCTCAGAGCTGCCGCGCTGGCACATCTTCCTGGCGAAGGGGAGGGTGCGGCTGCA
GAGAATTGAGACTTAGAAGCTTTGAATTCTTGTATCTGAGAACGGAGTCGTTGGGGGTGG
TGGAGGGGGTTGGAATTGGGGACCTACGGAAGGTGAGGATCAGCCTCCAGGCACAACAGG
GGAGAGGACGTTCAGTGGGCTTCAACTTGACCCAGGCCTTCTCCCCTTCAGGCTCAGCTC
TTGCCAGGCCAAATTGAGACATGTCTGACACAAGCGAGAGTGGTGCGGGTCTAACTCGCT
TCCAGGTAAGGCCTCTTTCTGTCCTTTCCCCAGCTGCTTTTCCTCTTCAGCCCTTGTTGC
TGCCCCAAGTCCCTTGGCTCTTCCCCTCCCATCCTTGTCCTTCTCCACCTACTTTCCTGC
CTGGGTGTCCCCCTGCCCAGTGGAGGGAGGGAGAGAAGGTGGGCGGGCCCCTCTTCTGCC
ATCAGTTCTTGCTCAGAGGAAAGGGAGGCCTTGTTGGGCTGAGGTGGTCAGAGCACACCG
CAGGTAGGAGTCAGTACAGGTCAGAGAAGTGTGGCCTTGGAATTTTGGAGCCATTTGCTT
AGTTGGGGGTGGGGAGAAGGTCTGTGAACTTCCCTGCTTCCTCTTGCAGGCTGAAGCTTC
AGAAAAGGACAGTAGCTCGATGATGCAGACTCTATTGACAGTGACCCAGAATGTGGAGGT
CCCAGAGACACTGAAGGCCTCAAAGGCACTGGAGGTCTCAGAGGATGTGAAGGTCTCAAA
AGCCTCTGGGGTCTCAAAGGCCACAGAGGTCTCAAAGACCCCGGAGGCTCAGGAGGCACC
TGCCACCCAGGCCTCATCTACTACTCAGCTGACTGATACCCAGGTTCTGGCAACTGAAAA
CAAGAGTGTAGCAGCTGACACCAAGAAACAGAATGCTGACCCGCAGGCTGTGACAATGCC
TGCCACTGAGACCAAAAAGGTCAGCCATGTGGCTGATACGAAGGTCAATACAAAGGCCCA
GGAGACTGAGGCTGCACCCTCTCAGGCCTCAGCAGATGAACCTGAGCCTGAGAGTGCAGC
TGCCCAGTCTCAGGAGAATCAGGATACTCGGCCCAAGGTCAAAGCCAAGAAAGCCCGAAA
GGTAAGACCTCTGCAGTCACCACCCTTGGTTTTCTACTCCTCTCTCAGTTGGTTCATTTG
TTCTACAAACATTTAGAAAGATCCCTGTGCTCATCAGGGCTGTGGGGGGCACTGAGAGTA
ATGTGATGTAATTCCTGTCTTCAGAGAGCTTGCAGACTGATGGGGAGGTGCAATCTGAAT
GTAATGCAGTTTATGTTTACATAGTAGCTGCCCTGTATTAGGCCTTGAGCTAAGCACATT
TATGCAGGTTGTCTCATTAAATCTTGAAAGTAATTCTCATAGCCCCAATTTTATGGAGAA
GGAAGCTGAGTTCCAGAGAGGTGAAGCGGCTTGTCTAGGATGGTTCAAGCAGAGCCAGTA
GTGGGCACAGAAAGAGAAGAAGACTCAGCCTCTACCCACCCTTGGTTTGCTCCTGGCCTG
CTAGGCAGATGATACACCTGCTTGGAAGTCAGTGAGAAACAAACCCAGGGTTCAGCATGG
CCAACATCTATTGAGTCAGACTGTTACTACAGGGGTGGGAGTAGCGGCTGCTTCCTGGAA
GAGATAGGGAGAGGAAAAGGACCACTTGCTTCATCTGGTGATGTTGAGCTTCCTCTCTGT
TGATACAGGTGAAGCATCTGGATGGGGAAGAGGATGGCAGCAGTGATCAGAGTCAGGCTT
CTGGAACCACAGGTGGCCGAAGGGTCTCAAAGGCCCTAATGGCCTCAATGGCCCGCAGGG
CTTCAAGGGGTCCCATAGCCTTTTGGGCCCGCAGGGCATCAAGGACTCGGTTGGCTGCTT
GGGCCCGGAGAGCCTTGCTCTCCCTGAGATCACCTAAAGCCCGTAGGGGCAAGGCTCGCC
GTAGAGCTGCCAAGCTCCAGTCATCCCAAGAGCCTGAAGCACCACCACCTCGGGATGTGG
CCCTTTTGCAAGGGAGGGTAAGAACTCTGTCGTTTTTACTCTGCCTTTTCTACTGCCTTG
GCTGCCCTTTTCTTTGCCATCGTCTCAAGTTTTCTGCAAACTTGTTTTGGTCTTTCCATC
TTTTTCTACTCTGCCAGGCAAATGATTTGGTGAAGTACCTTTTGGCTAAAGACCAGACAA
AGATTCCCATCAAGCGCTCAGGTAAAGTCCTACCAATCCTCCCTCTGCCCTGAGCTCTGC
CCTCCATTGCCCTTACACCATTGTGCTGGGGGATATCCCTTGCTCTTATGCTCATGTCTC
TGTCCTCCCAAAGTTTTAATTTGGCAGTGCTGGCATCTCTGTTGATAAGCACAGAACCGG
GTTATGCCACCCTTGGTGTGGTTGGCAAAGAGTCTATAGCTTGGGCATCAGGGCCACCTG
GCATCTCTTCAGTCAGGTGCTCACAACACTCTCCCCTTACAGACATGTTGAAGGACATCA
TCAAAGAATACACTGATGTGTACCCTGAAATCATTGAACGAGCAGGCTATTCCTTGGAGA
AGGTGAAGGGGCAGCCCTGGGGGATGGGCACAGTGGGGAAGCCTTGAATTCAACAAAAAT
GTACGAGTCCCTTCTCGGGAACCAAAGAGACCTGCTAATCCAGCTCCATCACTATGCTGA
GGGGCAGACAGTGGCCTAGGGAGGGGTGTAGATTAGCGATGGGTCACACAGCAAGTCAAT
GGTAAAAGTACAGCTAGGACCCAAGACACCCAACTTAGTCCTGCCTTCTGTCCGCAGCTC
CTGCCATGTATTTGAGATTTCACCTCTCCCTTTCATTCCCCATTCTCTGTCTCCCTAGAG
TCCCACTCATCACAAAGATGATGATGACAATGGTACATTTGCAGTGTGTTTACCGGGTGC
CAGGCACTTAGCTATGTACTTTGTGTGCATTATCTCACTGATTTCTCACACATGCAAAAC
TCCTAGGTACATAGGGAGCTGCAGCATGCCCCGGAAGCTGAATTTTGTCATCTCACAAGC
TGTTCTCCCCATCCGCAGGTATTTGGGATTCAATTGAAGGAAATTGATAAGAATGACCAC
TTGTACATTCTTCTCAGCACCTTAGAGCCCACTGATGCAGGCATACTGGGAACGTAAGCT
GGGAAAGGGCTGAGGTGTGGGGGGGCTTCTGCTTTGGCCATGTGCTGCTACCCCTTCTTT
GTCCTACTTCCCCCATCCTCTTAGAGAGTCAGGAAAGACAGGGTCTCAAAAGCCCTGTCC
CAGTTCCCATGCATAGTTGGAGCCCTGCTCACAGTAGTGGCACCTGATTATGATTGACTG
AAGGGTGTAGGAGCCTGGTGTGGGACATTCCTGCTGTCAGGTTTGCTGTCTCTGTAGAAG
CTTCCCAGGAAAGCAGGCCTGTCATTGCTTGCCTCTTCCTACTGGGTGCCTGGCCTGGCT
TTGGCAGAGTGGTTCTCAAGGAGGGCTTCCTGGTGTGGGTGGATCAGGATGCGTGAAGCG
CAGGAGTGTCAGTGGGGCTGAAGGTTCTGGGACAGAAAGAAGGGACTCACATTGACTGAG
TGCTTGTGTTGTACCAGGTTGACAGCCATTCTTCCGTCTTCTTGGAAACCCAGGGAAGGG
AAAATATGATTTTTCTATTTTACCGAAGAGTAGACTGAGGCTTGCAAGTCTAAGTGCCTT
GCCCAGGGTGGCATAGAGCTGGAAGCAGAGACTGGGCAGAATTCTGTATCTGAGGAATCT
GGGACAGGCTAGCCTAGTGAGTTGGCTTGTGTGTCTATTGCAGATGGCTGCTGAACATAA
ACCTCTCTGTCCTGTTATTTCTCTAGGACTAAGGACTCACCCAAGCTGGGTCTGCTCATG
GTGCTTCTTAGCATCATCTTCATGAATGGAAATCGGTCCAGTGAGGGTGAGTGGCTGGGC
TTGCAGCTGAATGGGTGGCTGTGGTCTAGATTCCATGTGTTCAATTTCTGTCCCTGTCTC
CTCTTGCCTCCCCTCGCAGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCT
GGGTATGATTGGGCTCTCTCAGCGCTTGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGACG
GTCCTAGGATTGCATCAGTCTGGTGGTCTGGTGGAGTGGGTGGGGTGCTGGACTGGGTAG
ACGGCCCAGGGTTCTGACCTGGGTGGATGATGGGCGAATGGTCCTGAACTCTCTGCTCCC
TCTCTCAGTGTCTCTTGGGCTTCTATGGAGCTTCCCTCTTGTGCTGGAAACCTCTTTTCC
ATCTTGGAAATGCCTCTGCCCACATCTGGGAAGTGCCATGGCCTTGAGTGAATTTATTTG
TTTATTTATTTTTCTTTTTCTTCTCTCAGGATACATCATTCACTCTTTGGGGACGTGAAG
AAGCTCATCACTGATGAGTTTGTGAAGCAGAAGTAAGTATCTCTGTCTGGTGTTCATGTG
TTCCATGCATTTGGCCTATTTCAGAACTGAGTGATAAAGCCATGGTGCATGCATGCATGT
GTCTATGTGTGTATGTATTTGCATATTTGCATGTATGCAGGTGGGATTATTCCTTGGGCG
GTGATGGGAAACAGGAGCAGCACATGTTTCCTGATCTGTTACATATACTTCAACATTTGT
CTTGAGACCAGTTCTACAAGGGAGGGATTATCATTACCATCATTGTACGTATGCAGAAAC
TGAGGTTTAGAGAGGTGAAGTCATTTGGTCAGGGTTACACAGGTAGCAAGTAGAAGAGTT
ATGTTTAGAACTTGGCTCCAAAGCCTTAGTTCTTTTTACTCTGCTAACTAGAGCTTCATA
GAAATTAATTTCCGTAAAGAAATGACATAGAATGGTAGCTTCAGGCAACCAGGTACCATG
CTGGGGAGTTAACTTGTACATCTCATTTCATTTTCATAACTACCCTGCAGCTGTCATCCT
ATCCCCGTTTTACAGTTGAGGGACCTGGGGCTCCGAGAGGGGAGATCTGAGCATGGCCCA
CAGCTGGTATGGGCCTGGAGCCCAGTCCTCTTGAATTTCTGGCCAAGGCTCACCTATCCT
TGGTCCTTGGAGGACATGCGAACACTCAGCCACACGCATGTGCACACAGAAACACACACA
AAGGGTCAGGAATTCAGCATGTGTGAAGCATGCTGCTATTGGCTATTCTTCCTCTGTAGT
CTTTCTGGTCATTTTCTGTGGTGGACCTTTCTGGGCTTGGCCAGGCTGAGGCCAAGACAC
TTGCAGTGGGGTGTGCTCAGAGCAGGGGGCCCAAAGAATGGCTCCTCTGTTTACAACACA
CCCAACAGGAATCTGGGGTCATTGTGATGAGGGCGTCAAACTTGTGGCTTCCCTATGAAC
AAATGTCCCCCAACACCTCTATGTGGCTTCTGGGCAAGACCAGTGGGACAGGGCTCAATA
TTGGAAGAAAGACTGTAGTAATTAGTGGATAATGTTGCCATCTGGAGCCTGTCCAGTCTA
TGCATGGGTAGGCCATGAATGGTCTTAGAAATAAAGGCTTTGAACCTCTCTTTCCAAGGT
ACCTGGACTATGCCAGAGTCCCCAATAGCAATCCCCCTGAATATGAGTTCTTCTGGGGCC
TGCGCTCTTACTATGAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTGCAAGGTAATTG
GAGAGCTGCCTGAGCTTGGCAAGTCAAGAGCAGGGGGTGCCCCTGGCTGGGGCAGGCTGT
GTGCAGAGCAGCCTGCAGTTCAAATCTGAATGTTTTGGTGCTTCTGTTAATTGTCAAAAC
ACTGTAACAGGCACTTTTTCTGAATCATTTAAGCCTTACAACCTGATATGTCATTGCCCT
GTTACAGATGAGAAAACTGAGGCCCAGAGAGGTTGGTAGGTGACATGTCCAAAGTCATGG
AGCTAGTAAGTGTCAGAGCAGGGATGGAGTATTAGGTGCATAATTACTGGTAATACTGTG
TTATTACTATTATCTTTTTATACTAAGCATGTAGCATAGTGCCTAGCATAAAGAGTAGAT
GTTTAATCCTCTTATGCTCCTTCTGATGGTTATTTACATAGTAAGACTGTATTATTACTA
TGGCTTAATCCCTCTGTGCTCCTTCTGATGGTTATTTTTGTTTCAGGTACAAAAGAAGGA
TCCCAAGGAATGGGCAGCTCAGTACCGAGAGGCGATGGAAGCGGATTTGAAGGCTGCAGC
TGAGGCTGCAGCTGAAGCCAAGGCGAGGGCCGAGATTAGAGCTCGAATGGGCATTGGGCT
CGGCTCGGAGAATGCTGCCGGGCCCTGCAACTGGGACGAAGCTGATATCGGACCCTGGGC
CAAAGCCCGGATCCAGGCGGGAGCAGAAGCTAAAGCCAAAGCCCAAGAGAGTGGCAGTGC
CAGCACTGGTGCCAGTACCAGTACCAATAACAGTGCCAGTGCCAGTGCCAGCACCAGTGG
TGGCTTCAGTGCTGGTGCCAGCCTGACCGCCACTCTCACATTTGGGCTCTTCGCTGGCCT
TGGTGGAGCTGGTGCCAGCACCAGTGGCAGCTCTGGTGCCTGTGGTTTCTCCTACAAGTG
AGATTTCAGGTATCTGCCTTGGTTTCAGTGGGGACATCTGGGGCTTATGGGGCTGGTATG
AGGAGCTGGATGATTCTAGGAAGGCCCAAGTTGGAGAATGATGTGGAGAGTGTGCCAAGA
CACTGCTTTTGGCATTTTATTCCTTTCTGTTTGCTGGATGTCAATTGACCCTTTTATTTT
CTCTTACTTGTGTTTTCAGATATTGTTAATCCTGCCAGTCTTTCTCTTCAAGCCAGGGTG
CATCCTCAGAAACCTACTCAACACAGCACTCTAGGCAGCCACTATCAATCAATTGAAGTT
GACACTCTGCATTAAATCTATTTGCCATTTCTGAGTTTATTGCTTTTTTTTGGCGGGCTG
TCACATTTTGGTATCACATTTAAAAATCAGTGAGTTGGGAAAGTTTCCACCTCAGTCTGT
GTTTAGTTTGAGGTGATATTGTTGGATTCCCAGGAGCGAGATTAACACACCTTTCTGGGA
TAGATTGGGCCTCACGTCTAGCCTTCAGGGTGGTGGGATTTTAGTGGGGTGGAGTTGAAG
AGATTGTAGTTACAGAGGACACACTTTGAAGGAGAGGCTTGAGGTCGGCAAGTCTGGAGC
AGAAAGCGTAAGTAGAGGAGACTGGACATCAAATATAGAATCTCTTTTTGAGAAATTTGA
AAGAGGAGAGAGAGGTACAGAGCTAAATGGAGATGCAGGAACAAGGGAGCATTTTCTTGG
GGAAGGAGAGAGAGACTTGAGTAGGGAGGAGTCAATGGAGAGGGAGAAGTTGAATGTTGA
CTTCTGCAGCCCAGTCCTGGAGGAGGTGAGAGGAGTCGGGTTGTGGGAAGGCCTGGGAGA
AGGGACTACTCGGTTAGGACTCAGAGAGGGGGACTGTGAGAGGATGTTGAGCAGTAGGGA
GGCCCCAGTAGAGGATGGAGCCCATGATTTTTGGGGGAACATAGCAAGGTGCTCAGTAAT
CTTGGTATAGGAACCATGAAGATGAGTGTTGGTTTATTCCAAGGTTTGGGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1071, 2571..2644, 2989..3480, 4088..4396, 4517..4580, 4842..4921, 5418..5512, 6206..6285, 6379..6421, 6749..6811, 7918..8032, 8506..8952
2600..2644, 2989..3480, 4088..4396, 4517..4580, 4842..4921, 5418..5512, 6206..6285, 6379..6421, 6749..6811, 7918..8032, 8506..8937
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved