Pongo_pygmaeus Locus ENSPPYG00000020363
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus ENSPPYG00000020363
Pongo_pygmaeus
ENSPPYG00000020363
X
SNORA11
6806..6933
9451
AATTGTCCTGGCGGACACCAGGTGGGTCTCAGCGGCAGCGTGATTGTATCACTGATAAG
GAAGAGGGCTGACAATCTGAGTAGAGAGTGGACCCGGTGGAGCAATTCTCATACCTGGAT
GGACCCACATAGAGCCGCAGAGGCTGGGGGCGAGGCGGGGGGAGGCTCTGTCTCCCTGTG
TCCTGAATGCAGAGCATGAGCTTAGGCCTTCTACAGCACAAACCTTGCTTCTTTGGGACA
GATGTTGGCGTGGGGGAGGCCTGTCACTCAAACGGAGGAGGCAGTGCCTCTGTCCCCAGG
TCCGGAAGACCCAGGCCCAAATTTTGCATTTTCTGTTTCCTGGCTCTGTGGTCTAGTTCA
TGCAATGTGTCTGTGCCTCAGCTTCCTGATCTGCCAAATGGGGATGCTGACATCCACTTC
CCAGCGCTGCTGTGAGAGGAAGAAAAGCCCCAGCACAGATCCCTCTGTGACATACAAGCT
GCATAAAGGGTAGCTGAGGAAGCAGATGTTCCCAGTATGTCTGGGGGCCAGAGAGTTGGC
TAGTGGAGAAGCACACAAAGCGAAGTGCCATCCTCTGGCCATGTCCATTTCGTAGCCCCG
CAGGTTGAGGATTTCCACTTGTTGCAGTTAGAGACCCAGCTTATTAATTGTGAGACCTCA
CTAATTGTGACCTAAGGGGTCGTGCCGGGGAAACGGGGCATAGTGTATCCCAGACTAGGC
TGGAGGAGTTTGGGTGAAAGGGCAGGGCAGGACAGAGAAGCATTGTGCAAAAGTGGGGCG
ATTGAGAAGAGATGATCGGGTGGGTCGAGCTGCACTGCAGGGTATGAGTGTGCGCGCCCG
CGGTAGGAGGAGGAGGAGGAGAGGTGAAGTGGATCTGGCGGGAAGAGCCCCCCCACCCTA
CCTTCGACCCCACCGCCCACCCACCCGCGGAATCGCATGCGCACTGGAGACCTGGAGGAA
AGGGCTTTTGTTGGGAAAGCGGGCGGGCTGGAGGGGTCCGCGCATGCGCAGGCTACCCAG
CCGCGGGGGGTGCACGGAGAAAAGGGGCGGGGTGGTCCGGGCTGCTGTGCTGGCAGCAGT
AGGCGAGGGCGCGGCTGCGGGGTTCCTGGTGCTGAGGACGGACGCCATTGGAGCCCCCGA
GAAGGTAAGGATCCAGCCCCAGACAGGACCGGGAGAGGGCGAGTGGAACCCGACACGCTG
CGCCCTCCCTCCGCCTCCGGATCTGAACAAAGCCCAAGCACTCAGAACCGGAACCCCATT
AGACCCAAGGTCTAGATAGGAGCCCCCATCACCATCAGACCCAGGCGCCCCGATCTGAGC
CCTACTGAAACCGGAGCCCAGGATCCTCACCCCTTTAGCAGACCCGTGTGTTCCGAGCTG
AGCTCCCTCGGACCTGAGGCCCCACCCCCACCCCAACCACTCCTAGATTACTCGAACGGA
GCTGACCGCTTGCCCCCTTCCTGGAGTGCCCAGTCCTCGCGTTTGAGATCTGCAGCGCTA
GGTGATTGGAGCCTCACCTAGGTCTGAGGCCCCCACTCCATCCGCCTCTAGTGCTCGAGT
CTGAGCCCCACCTAGGCCCCCCGCCCGGACCTAGCCAAAGGTCCCTGGGGTTCTGTTTCG
CAGAGCTTACGGCTTGCCACTGTCCCCGTTGTCTGAGCTCTCCCGTCTGCTCCCCCTTCA
TCCTGGTCGCCTTCTCTGGCCCTTAAATCCAAACCCTTTGTTTCTCTCTTCCCCAATGCA
TCCCCTTTGGGACTCTTCGGACCCCGGCCCTCCAGAACACCCCCTCGTCAAATCTAGCCG
CTGGGATGGCGAGCCTGCCCATCCTAAACTCCGCTTTCAGTGCGGCGCCTCCTGCGACCT
CCTCTGTCCCTTTCCTTGGGCTCTGTCCCTGACCAGGTCTACCGCATCAGAAAGCCAAAC
CGTCTCCCCCCCACTTCCCCCCCCCCCCGCCCCCTACTGCCTAATATTGCCTAGTAACCT
GATGATTGTTGCCCCTCACCTCCCGGGAGATCCCGCCTCCCATTGGATCCCGCCCCCTCC
CCCTGCAGCTGCTTCACCCTCCCTCTCAGGCTGAGCTCTCATCTCCCTGGGACCCGCAGC
ATGGCTGAGGGAAGCTTCAGCGTGCAATCGGAAAACTACAGTGTTGAAGACATGGATGAA
GGTAGCGACGAAGTCGGGGAGGAAGAGATGGTTGAAGGCAACGACTATGAAGAATTCGGT
GCGTTTGGTGGCTATGGCACCCTCACCAGCTTTGACATCCATATCCTCAGAGCCTTCGGA
AGCTTGGGTCCAGGTCTTCGCATCTTATCGGTGAGGCCCCTTCCTGGCCACCTGCTGGCC
TGGGCCTTTCCCCTGTGAATGGGGGAGGGAGGAGCGGGGAGCAAGGAGGGTTGTGTGGGA
AAGGACTGCCCAGCTTCCCCAAGCCTTCCCTCCCCTGCTCGGAAGAAGAAGATTTGGAAA
GGTCTTGGGGTGTTCAGGGCTGACTGCTAGGAAGAGGCTGGCCAGCACAGGGAAGCTAAC
ACAAGTATGTCGTCGAGTGGCCTGCCTTCTCCAACCCCTCTCTCTGGCCTTGCAGAATGA
GCCCTGGGAACTGGAAAACCCTGTGCTGGCCCAGACCCTGGTGGAGGCATTGCAGCTGGA
TCCGGAAACACTTGCCAATGAGACGGCCGCCCGTGCTGCCAACATAGCCCGCGCCGCCGC
CTCCAACCGTGCGGCTCGGGCCGCTGCCGCCGCTGCCCGTACCGCCTTCAGTCAGGTGGT
CGCTAGCCACCGGGTGGCCACGCCGCAGGTCTCAGGAGAGGATACCCAGCCCACGACCTA
CGCCGCCGAGGCTCGGGGGCCCACCCCTGAGCCACCCCTTGCTTCTCCGCAGACCTCCCA
GATGTTAGTCACCAGTGAGATGGCTGCCCCCGGGGCTCCGGCAACCTCCGCACAGTCCCA
GACAGGCTCCCAGGCCGAGGAGGCTGCTACCGAGGGCCCTAGTAGCGCCTGTGCTTTCTC
TCAGGCTCCGTGTGCCAGGGAGGTGGACGCCAACCGGCCCAGCACAGCCTTCCTGGGTCA
GAATGATGTCTTTGATTTCACTCAGCCGGCAGGTGTCAGTGGCATGGCCTTTCCGCGCCC
CAAGAGACCTGCCCCAGCCCAAGAGGCTGCCACAGAGGGCCCCAGTGCTGCCTCCGGTGT
GCCCCAGACGGGACCTGGCAGGGAGGTGGCAGCCACCCGGCCCAAGACCACCAAGTCGGG
GAAGGCGCTGGCCAAGACTCGGTGGGTGGAGCCTCAGAATGTTGTGGCAGCAGCTGCTGC
CAAGGCCAAGATGGCCACGAGCATCCCTGAGCCGGAAGGTGCAGCTGCTGCCACTGCTCA
GCACAGTGCTGAGCCCTGGGCCAGGATGGGAGGCAAGAGGACCAAGAAGGTGAGAGCCCC
CTGCCCCCTGCCACCTCCACACCCCCTTGCTCCTGTCCTTTCCTTCTCCTCCCTTTCCTG
CTCCTCTCCTCCCTCTCCTCTCCCCCTTCTTCCTCTCTTCTCCTCTTTCCCCTCCTTCTC
TCCTCACCTCCCCTTCTCCTCCCCTCCTCTCCTCTCAGCTAGTCCATGTTTCTCCAACAC
AAGTTTGCTGAGCATGTTTTCACTCCACGTAGTCCCTACCCTCAGGACTGGTGGGAGAAG
AGGCTGGCTCAGTGCCTGGCACTTAGTAAGCACGCAGCACATGCCAGCAGCTGCTGGTAC
TGCTCTCATTTCCAAGAGCCTGCTACGGGTGAGGTGCGTGCCGGGTGCTTTGGCACGGGG
AGCCTGGTAGCCCTGGGTCTCTCCTCTCTCGAATGATACAGTCCAAGCACCTGGATGATG
AGTATGAGAGCAGCGAGGAGGAGAGAGAGCCTCCTGCGGTCCCACCCACCTGGAGAGCAT
CACAGCCCTCATTGACGGTGCGGGCTCAGTTGGCCCCTCGGCCCCCGATGGCCCCGAGGT
CCCAGATACCCTCAAGGCATGTACTGTGCCTGCCCCCCCGCAACGTGACCCTTCTGCAAG
AGAGGGTAAGAAGCCCACCCTCCCCCATCTCCCTCCTCTCCTCCCTTGTGGGCCACGTCT
CTGCTGTCACCCATGCCTTGACCTCCCCGCGTGTTCCTCCTTCTCCAGGCAAATAAGTTG
GTGAAATACCTGATGATTAAGGACTACAAGAAGATCCCCATCAAGCGCGCAGGTAGGCAG
CCTGTGCCCTCTTCGCCATCCCCTAGTCTGTGGGCATCCCTTTGCTTGCGTGCCGCGGCT
GGTCCCTCCGTAGCCACGGGACGGGGTCCTGGCTGCGCCACCCTCGGCAGGGCTGACCAA
GGGGCTACAGCTCTATGACCCCTGCTCAGCCCAGGTGCTTTCTCCAACTCTTCCCCCTCC
TGCAGACATGCTGAAGGATGTCATCAGAGAATATGACGAACATTTCCCTGAGATCATTGA
ACGAGCAACGTACACCCTGGAAAAGGTGGGTGCAGGATGGGAGCAGCTCTGTGGAGGAAG
AGCGGGCATGGGGGTGGGGTGACCCTGCAGCCCCTCAAGGCGCAGTCTCTGGAGCCATCT
CTCACCTCTCCGACTCTGAGCTTCCACTGCACTGGCAGTTTGACTCGTGCTTCCTGCCCT
CGGCTTCTCTCTCTCATGCTCTCTGAGTGTCTCGCTGTCTGGCCAGGTGGGTCTCATCGC
CTCTGCCAGCGTCAGCTCCCACAGCGAAGGTCTTCCGTGTGCTGTCTTCTTCTGCCCTCG
CTCACGAGTTTGGATTCCTTGCTGAGGAGCAGTTCTAACCGGGAATCACTGTCTGCCGGC
AGGATGCCCAGCATGGGGTTTGGATCTCACACTCTGTTTTCTCCCCCATGTAGAAGTTTG
GAATCCACCTGAAAGAGATCGACAAGGAAGAACACCTGTATATTCTTGTCTGCACACGGG
ACTCCTCAGCTCGCCTCCTTGGAAAGTAAGAAAGGGAAAGCGGGTCGTGGCCTTCCTCGG
TGGTGTCCCTTCCCTGCCCACACCCCTTCAGTGAAGCAGGAAGACGGGGCTTGAGTGCGG
CGCACGGCTCCCACACACAGCGAGGGCTGCCTGGTGACTGCTGGATGAAAGGAATGATAG
CCTGGGGGTGAGGCCTTGCTGCCATCAGGTCTCCCCAAGCTGCTGCCGGGCTTTATCCCC
AAAGCTTCGGAGGAAAGCGGCTTGCCTCTTCCTCCTGCCTGCCTGGCCTGGGCCCAGCAG
AGCTGGCCTAGGGGAGAGCTTCCTCTTCAGTGTAGGTCCTGATGTGGAAGGGGCAGGAAA
GGTCTGGAGCCATCTCTGGACACACGTTTGCCATTTGCAGAGCTTCGGCTCCCTGCCTCG
CCCTGTCCTCTGCAGAACCCTGTCAGGGAAGTGTTAGTACCCATGTTTTATAGAGGAGGT
GATTAAGTCTCAGGCGGAGGTGCGAATGGTCTGCCAGCAGCTAGTGAACTGTGCCCTGTC
CTGGGAAGAGTTCCCCTCAAGCTGGGAAACCTGAGAGAGGCTAGTTGGGAGAGCCTGGTG
GTGTCTCTCAGGCAAATAGCTGCTAAACAGGATTTCTCTTTCCACACCTTTAGAACCAAG
GACACTCCCAGGCTGAGTCTCCTCTTGGTGATTCTGGGCGTCATCTTCATGAATGGCAAC
CGTGCCAGCGAGGGTGAGTGGCTGGACCTGCAACTGGGGGGCTGCCCATAGTCTCATCTT
CTGGGTGCCAAACTCTCGTACCTCCTCTCCCCTCGCAGCTGTCCTCTGGGAGGCACTACG
CAAGATGGGACTGCGCCCTGGGTATGATTGGCCTCTCCGGCTCCTCCCCTCGGTGCTATC
CTCTGGCCAAAGAGGTCCTGGGATTGCAATAGCCTGGTGGTCTGGCGCAAGGGCGTGGGG
CGCCCTGGGCTCGGTAGAGAGCAAAGGATCTCACCGGGGCGGATGGGGAAGCGGTGCTGG
ACGCTGCTCAGCCCCCTCTCTGCTCTGTGACCCCAGATGACATCTAAAAGAGACAGTCAG
AGTCGGGGGTTCCATCAAATCCCTACCTGGGGCATCCCTGACCAACAGTCCTCTGGCCTC
TGCTGCATGCCCAGGCCTCCACAGCGACTCCCCGTGGGCTGGGAAGTCATAGTCATGCTA
GGGAGGGCCCCTGCCACCGTCTCTGCTCATGGATTCCTTTCCTTGCCCTCAGGGTGAGGC
ACCCATTCCTCGGCGATCTGAGGAAGCTCATCACAGATGACTTTGTGAAGCAGAAGTGAG
TATCACCCCAGCTAACTGCGGCTCTCCCTCGAGCATCCTTTGTGTGCTGGTCTGGCTGAG
AAAGCAGTTCCCTATCCCAAATCTTCAACGGGAGGGATGGGTGCCTCTGGCCTGGGAGTG
AGTGGCAGTGGGGGTATGCGAGCGTGTGGGGAGCCGAAGGCCAGGGCGGTCTTGGGAAAA
GGGAGCGCACGTCACCTGAGAACACGGTGTGGGGTGTGAAAACGGCCACCATCTCCTTGA
GCACCTGCCCTGTAGACTGACACAAGAGTTCCCCCTGGTTTACACCTAAGGAACCCGGAG
CTCAGAGAGGGGACGCCTCTGAGCATGGCTCCCAGCTGGTAAGGGCCTCAGCCCAACTCT
CCTGATTTTCAGGCCAGGGGCCACCCTCTCCCCGTCCCTGGAGGACTTGCCAACGCACAG
GCGCGCAAGCACACCAACAAAGGGTCAGGACTTGAGGAGGATGCCTGGAGCACGCTTCTC
CTGGCTGACTGTTTCTTCCTCTCCAGTCGTTTCCTCTGGTGGGCCTCTCCAGGGCTCCAC
CGGGGTGTGGCCAAGACCCTTGAGGTGGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGG
CTCCTCTGTTTACAACACACCCAACAGGAAGCTGGGGTCATCGTGATGAGGGGCACAAAC
TTGTAGCCTCCCTACAGACAAATGCCCTACATGTGGCCCCCCTGCACCTCCGCATGGCTT
CCAGGGAAGACCAATGGCAAAAGGCTTTGAAGGCCTCACTTTTGCAGGCAGAAGTCCTGG
GAGTGGGTTTGGGAATGAGTGAAGGGCTGGAGGGGCAGGGCAGTCCTCTTCCAGGAGCTG
AGCTGCGGCATCGGGTTGAGGAGGGGCCCCCTGGAACCCATCCGTTCAGCAACAGGTCTG
CTTGGCTAGAAGCAAAGTTTACTTTCCTCTCATGCCAAGGTACCTGGAATACAAGAAGAT
CCCCAACAGCAACCCCCCTGAGTATGAATTCCTCTGGGGCCTGCGAGCCCGCCATGAGAC
CAGCAAGATGAGGGTCCTGAGATTCATCGCCCAGGTAAGGGAGCCTCTGTTGGGTGCCCG
GCACCGGGGGTGGTGCTCGCCACACCTTGCTTGTTTCTTGGTCGAGGCCTCCTTCCCATT
ACCCCGTATTCCAGTGAGGGTACCAAACACTCACAGAGGCACCTGAGCACCCTACACAAG
GTCACAGACGGGGCAAAATCCCAGGTCTGGCACAGGGGAGTAGGAGCCCCCAGTCCCTGT
GGTCCTGATTTTTGCCGTCATTGCACAAAGCACACGGGAGGGGGTGAGGCAGGCCGCGGG
TGCTCAGCCAGTGTGGGGTAGCTCTGTGTCTATGCTTGCCCTTTTCCTCCTCAGAATCAG
AACCGAGACCCCCGGGAATGGAAGGCTCATTTCTTGGAGGCTGTGGATGATGCTTTCAAG
ACAATGGATGTGGATATGGCCGAGGAACATGCCAGGGCCCAGATGAGGGCCCAGATGAAT
ATCGGGGATGAAGCCCTGATTGGACGGTGGAGCTGGGATGACATACAAGTCGAGCTCCTG
ACCTGGGATGAGGACGGAGATTTTGGCGACGCCTGGGCCAGGATCCCCTTTGCTTTCTGG
GCCAGATACCATCAGTACATTCTGAATAGCAACCGTGCCAACAGGAGGGCCACGTGGAGA
GCTGGTGTCAGCAGTGGCACCAATGGAGGGGCCAGCACCAGCGTCCTAGATGGCCCCAGC
ACCAGCTCCACCATCCGGACCAGAAATGCCGCCAGAGCTGGCGCCAGCTTCTTCTCCTGG
ATCCAGTAAGAGTTTCGGTAGAGAAATGAGACTCTGCAGGAGGGCTGCGGAGGGGGGTGA
TATGTCAGAGGGAGGGCCGGGGTGGGGGCGTTGGGGGCAACGGCAACAGCATGGACAGAC
ACTTATTTTGTTACGTATACTCCTCCCTGGTTCGCGTGTGTCCACGGATGTTGTCACTTT
GGTTTCTTGTGCTTTTACAGGCACCGTTGACGAACTGCAGCGATCTTACTGGCCAAGCCA
GAGCGCCTCCTCTCAGATTCCTTCTCGACACAGCACCCTAGGCGGCTTCTTCCTGTCAGT
CAGAGGTGGCATGCAAGATGAAGCTCTCTTTGCTCTTCCTGCTTTCATTTTGCGCTTTTC
CTTGTGCTTTCATGTTTTGGGTATCAGTGTTACATTAAAGTTGCAAAATTAATTTGAACG
TTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCATGCTTGGGCTTGTAGCAAGG
AAACTTCTTCAGGCTCTCTGGGGTAGGTGGGCCCCACCTCTGCCAAAAAGGCCCACAGGG
ACAGGTGGGATGCTGGGAGGTGCGGAGGTTGGTTACGCCTGAGTGTGCGACCAGGAGTTT
GGAGAGGCCCCAGTGCTCATCGCTATGTGATTTTCTACAAGCCTTGCTCAGCAGCCCCAG
GGACATGGCAAGAGGGGGGGCCAGAGCAGGGGCGGGGCAGAAAACTGCAGCTTGGTGCCA
CTGCCCCTCCCGCCGTGGGACAGGGTCTAAGGCTCTCACCAGGACCCACCTCCCACACCC
CCTCCTTGGAGATGATGTTCCGGAACGCTTGGCTCATCATCCACACAGTTCAGGACCCCG
TCCTCGGTACAGAGTCTGACGGACAATGAGGTGGGCCCCGCAGTGATGTTCGCAGCCCTC
CAGTGGGTAGAAGGAGGGGCCGTGATTGCTGAGGGAGCAGGATGTGATAAAAACGACGCA
CGGTGCACGCGTACACAGCCCCTTGCCTGTGACGGAACGGCGGCCTGTTTGGGGCTTCGC
AGCCCTTCTCCCTCAGCAGCAGGACTCTCCCAGTGAGGACAACACCAGGCCTACCTAGGT
CCTGGTGTGTTCAAGGGCTGGGTGATGTCTGGAGGGGTGTGAGGTAGGGCTGCACATGCT
TCAGGTACAAGACGGTGAGGGCAGAGACAGTTTGGTCTCCTGGGAAGGGCTCAGTGGCAC
GCAGGGACAGTGTCCAGGGCTTTCTGGAGTTCCCCGGTAATGTCCAGGGCTTGGGAGGAC
AGAGCCCTAGATAAGGAGGGAAAACATAGCAGTGGAAGGCTCCCTGCTTCCCACCCCCTC
ACCCAGCCCCAGCCTCTGTTTCCCCAGGAGGGGCTGCCATCTCCGCCACGGCCAGATCCT
GACCCAGACCAGGCTAATGTGGGAGGCCCGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 2099..2309, 2575..3408, 3821..4024, 4128..4191, 4385..4464, 4853..4944, 5573..5652, 5738..5780, 6172..6234, 7179..7293, 7614..8044, 8240..8451
2100..2309, 2575..3408, 3821..4024, 4128..4191, 4385..4464, 4853..4944, 5573..5652, 5738..5780, 6172..6234, 7179..7293, 7614..8044, 8240..8246
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved