Pongo_pygmaeus Locus RPL5
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPL5
Pongo_pygmaeus
RPL5
1
SNORD21, SNORA66
6222..6316, 9615..9747
11775
CTGCCCAAGACGTGGAGCACCTTTGGTAGGCTAATCACTTGATAATCCACCAAAATGAA
GGTTTTTAAATATTTTCTATAAATACGAATCGAATACCTCTTTCTTTACCCTTCCAAAGG
TGGCTCTACAAAAATAGAATCACACTTCCTGTGAAAAGTGGTTTAAGTTTTCTCCTCTAG
AGCTCTGTTGACATCGGCCATAGTGGACTCTGTTTGTTTTTCCTATTATATAAGGAATTA
CAAGTTGGAATCAGAGGTAACTGGCATCCTAATTCTGATTTATTCTAGTGGCAGTGTTTT
GGAGTCACTTAACCCTGTCATCCTGGCTGGCCGTCCCTTCTCCCAGCTCTGACGGTGAGC
AGCTGATACCCTGCTATGTGATGGAGAGTCAGAGGTGGACATCAGGGCCCACCTCGAAAA
GTTGACAGTCTGTGGTGGGCTGAAGCCAGTAGAAAGCTGCTGTAGAAAGGCAGAGGAGTG
GCCCCTATCCCAGGCTTGGGGCTCTCAGGGAAGGCTTCCTGGGAGTGAGATGGGAGGGTG
GGTCCGTATGCTCTTGGACCAGGATGAGTAGCCCAGAGAAGGCAAGAGGGCTCCCACGCA
AACTTGTCCTATTTAATTTTATTTTTTTTTCCTGCTTAGAAAAGCAAAATACGTTTGTTA
TGAACAAAACAAAACAAAACAAAACAAAACAAAACGCTGTAGCAAAGAAAGCGAAAGGCT
CCAGTAATCCTCCCTGCTCCTCCTCACCGCACTGATCCTGTGAGATACCCCGAGCGTTGG
AACCTTGAGAGCTTAGGCAGGCATTCACCCTCCTTCCAGCAGGGGGCGGAACGTAAAACG
CCTTGTGGCCGACGCCCTCTCTCTTCCACACGTCACTGGCGCCACCGTCCGCGCTACATA
CTGCGCCTGCGCAAAGGCTGTGGCCTTTTTCCCACCCCCACTAGCTCCGCTGGGCCTGCA
GGTCTCTGTCGAGCCGCGGACTCGGGTCTCTGTTCCGCAGGATGGTGAGTGGATGCCTCG
GTCTCGGGGCTCTAGATGCACGGAGGTTCCCTTTTCTAGCCCGTACGCCAGCCTAGGGCC
CGTCTCGCGCGTCGCAGGGGCCGGATGGCGTTAGATTGCTAGCTCTGACTTGATGGAGGT
GCAGTTCCCAGCGTGGCCTTAAATGGCTGCCGCCCGGTGCGCGAACTTTGGGGGGAGGGG
TTGGCGAAGAAGGGTAGCGTGAGCTTGGACGGCGGATTGGGGAGAAGGGTGAGTTTAGTA
GACAGCCTGAGTGGGGATACTGCCGTCTAGTGTGAGGGGGCGCTGGCCGGGCGTGAGAGG
TCGCAAGCAGTCGGCCTCAGCCTAGCTGGGGAATGCCAGAATGGAGAGGGGCTACAGGTC
CTCGGGTCCCACTCGATCTCCGAGTACCGAGTACTTCGTGGGTTTTTCAGAAGAATGTCG
GAGCCGGCGAGTCTTAGATTTAGGAAGCTTGTGCCTGTGGGCCGAGCAAGTGGTTTTTAA
GCCAAAATTGTCAGTGGAGCTTGGAGGCCGAGGGGTCCCTGGGCCCCGGAAGCTCCTTTA
ACATGCAATACGTGCCTCCTGCCTCTTTCTCTTGGGTCTGTCGCCGGATGAGTTTAATTA
TTGGGGTAGGGCCCCAAGGGTGGGATGAAATGTTGCTTTAGCTGATGGGGAACAGTGCTG
TTCCCCATCAGCACTGTGGGGGAATTACTGCTGAATGTGCTCTTGCCCAGTTAAGCTTTG
TGGCAGGTAATTTAGGCTTTTGAAAAGCGTAACGTGGGAAGCGAGAGAGGTATGTAGTTG
TTATTTGAGGCTACGTTTTTGAAGTGGGACATAGCGTGTTCCGAACAGACTGACGTTTGG
CACCACTGACTGCTGTCTAGAGCAGTGCTTCGCAAAAGTTTGGCACAATTACCGGTGCTG
GTCCTCGAAGAAACAAGTATGGAAATTCAGAGCGTTTAAAACCTTTTGAAAGCAATGTAA
CAATAATTTTATACCTGTTAACTGTAATAAATTGGGGCCTGCATTTTGTATGTTTCTTTT
ATTCCATATTTCTCTAAGGATTCATTTTTATTGTTTTATGAAACTACCAGTCTGTGACGT
GGAAAGTAGAGGAAAAAGATTCTTGACCCTAGTTGATTGTGAAACCTGGGATTCTACAAG
TGACAGTCGTCTGTTTTTACTCTTGAAGTTCAAGTGTTACTTTGTTACATGGTTAATTCA
TGTCAAAAGTATCATAGGCTAAGACATCAAAGTTTTAATAACATTCTTTTTTCTTTAAGG
GGTTTGTTAAAGTTGTTAAGAATAAGGCCTACTTTAAGAGATACCAAGTGAAATTTAGAA
GACGACGAGGTACTGTCACCTTTTTGTGTTTACAATATTAATCTGCTTTGCAGATGCAGT
GGAGTATCCTTTCTACAATTATTTTTTTCTTTCAGAGGGTAAAACTGATTATTATGCTCG
GAAACGCTTGGTGATACAAGATAAAAATAAATACAACACACCCAAATACAGGATGATAGT
TCGTGTAACAAACAGAGATATCATTTGTCAGGTAAGTTGTATTCTAGACATTCCCCTTTT
TTTATTGCTAGAGAAATTGTGCTTGGGAAGCAAAGCACATGGTGTGTGTGTTAGAAGGGC
TGTCTAGCACCTCCAAAAGCATCCAGTGAATAATTTTTCCTTTTAGTAGGTCTAGAATTG
GAACCTGGGAAATTGGTACTTTAAAAAATGCTCTTGGTTGGGCGCGGAAGCTCATGCCTG
TAATCCCAGCACTTTGGGAAGATTGCTTGAGCCCAGGAGTTTGAGACCAGCCTGGGCAAT
ATAGTGAGAGTTTGTCTTCACAAAAAATGTAAGAAAATTAGCTGGGCATGGTGGGGCGCA
CCTGTAGTCCCAGCTACTCAGTGGGAGGATTGTTTGAGCCCCGAGGTTGAGGCTGCAGTG
AAGTGAGATCACACCACTGCCCTCCAACCTAGATGACAGAGCAAGAGACTGAAACCTGTT
TTATGTGTGTGTGGGGTGGGGAGATTAGAAGCAAGAAGTTCTTGCCCATCCCAATTCCAG
TAGAATAGGGTTTGTCCTGATTTTTCCTATATGGCCTTATATGCCACTTAACCACTGAAA
AGGTAGTTGTGAGTTAAACAGGGCTTTAAGATTGTTCTGCTTATTCTTTGAAATAGGTTT
TAATAAAATGTACAAAGGTGGCTCCCACATGAAAGACCTTTAGGAAGTGTCAGTTTTGCT
CTTGTACTAAGAGCATTTTCACTGGACTCTGAAAGCTAGAATCCTGGGCTTTTACAACTA
GGAGAAATTCTGAGAGTTAAGATTTATTGATATTGTGTAGCAGGTAGGCACACCTGTTTC
CTGGGCAAATAGTTTGTTGATTGTGAAGGCATTGTCTTCCTCCGTACCCAAGTTCAGATA
ACTAAACGTTAGGTTCCTGAGACTTTGCTGAATTTAGTTATGTTTAGTTCAAAGGATGAT
TGAAATATTTGGGTATTCCTCTTTGACTTTTTAAGCACCTCTAATTTACTGGCAACCCAG
CTAAGAGTCTTCAGCATTTTAAGTGATGCACATCTATGTCCATCAATGTTTTTTTATTCC
CTTGAAAAATAATTAAGATGTAATAAGACAGTGAAAGCAACAGATTACTAACCTAGTTTC
TCTCTTACTATAGATTGCTTATGCCCGTATAGAGGGGGATATGATAGTCTGCGCAGCATA
TGCACACGAACTGCCAAAATATGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATA
TTGTACTGGCCTGCTGCTGGCCCGCAGGGTATGTACAAGATGACTTTAATTGATGTAGTT
TGTGGCTGATTGCTTGGAGAGTTTTCTGCAAGAGGTTTGTACATGGATAAGATAGCTTCA
GTTGTGCTTCAGGAGAGTGCCTGCTTCCAGTTTTCTGCTTTGTTAATGGATCTATTTAGG
TCAGCTCTTTCCAATAAAATTTTCTGCAATGACACAAATCTGTAATTTGCTGTCCAGTGG
TTTTGCCACTAGTGACCTGCAGCTGTTGAGTTCCAGCAGTATGTAAACTTGAATTTGAAA
ATCCACTTGTAGCTAGTGACTACTTAATTGGACAATGAAGACCCTTGCTACTTAGGTATA
CATTCTGAATGTTGGAAAACATTAAAAATGCAGACTCGTGGGAACTCCCCTCTAGACCTT
CTGGAATCTGTATTTTGATAGTATGTACCAAGTGATTTATGTGCACATTAAAACTGGAGA
ATCTTGGCTAGGCGCGGTGGCTCACACTTACAATCCCAGCACTTTGGGAAGCTGAGGAGG
GTGGATCACTTGAGGTCAGGAGTTTGAGACTAGCCTGGCCGGCATGGTGAAGCCCTGTTT
CTACTAAAAAAGTAGGAAAAAAAAAAGCCAGGCATGATGGTGTGTGTCTGTAGTCCCAAC
TACTTGGGAGGCTGAGGCAGGAGAATCACTTGAACCCAGAAGGCAGAGGTTGCAGTGAGC
TCAGATCACGCCATTGCACTCCAGCCTGGGCAACAAGAGCGAAACTCCGTCTCAAAAAAA
AAAAAAAAAAATGAGAATCTTAGTGTTTTGGAGAGTGGTCATTGATGGGAAGATTCATTT
TTGTTTTAAACGTTTTTCCATCTGGTTGGCAGTGTTTCCTGTATATGCTCTATTTTGCTG
GTAGATGAAGATGGGATTTTGCATTGTTTTTATTATCTGAGTTTTTTTATCTTGTTTTGC
AATGGAATTGTTAAGCATGTGCATCAAGGTTGATGACACAACCCACTCATCATTGGTTAT
AAAACATGTTTGAATGGAGGGGACATTGTAAGTGTAAGAATCAAGTTTATGCATTCTCAT
TGATTGCTGCATAAGTCAAGTGTGGACATGTAGCAAAGATGCAGAAGGCATAAAATTGTT
TCAAGTGAAATTGAATGTTTTAAGTTTTTTTTTTTAATAGCATTTAAAAATTCATGACCA
AGTGGATCTGGTGAAAGGGGTGGGTGTGGAAGGAAATTTTCTTTTCCAGATGTCAGTGGT
CCTTATGGTTATGACATAAGCTATTTTAATTTTAGAGCAGTTTGAATAATTCAAACCAGC
ATTTACATTGGTTTCTTGAATAGCTTCTCAATAGGTTTGGCATGGACAAGATCTATGAAG
GCCAAGTGGAGGTGACTGGTGATGAATACAATGTGGAAAGCATTGATGGTCAGCCAGGTG
CCTTCACCTGCTATTTGGATGCAGGCCTTGCCAGGACTACCACTGGCAATAAAGTTTTTG
GTGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCACAGGTAAGGATACTATT
TAAGACCTTGGTGCCTGGACTCTGGTACTTCCCTGTTTTTAACTAGTTGGACTATGGAGA
TAACTGAATTAAAGTAGCTATCATTGAATGCCTGCTGTATGCCTAGGTACCGTGCAGGAG
GAACCTAGTAGGGCAGGAAGGAATTATAGCCCATTTTATAAATTAAGAGTCTGAGGCCCA
GAGTTATTTGTCCCAAGTTTTTCGGGCCAGTTAGTGAAAGAGATGTGATTGAAACCACTA
CCTTTTGCATATGACTTTATTCTTATTAGAAATGAGCAACTCCATCCTCTTTCCCCATGC
ACTTTCTTTTTTTCAATCAGAGTAAAAATGATGTACTGAATTATGCAAAAAGGTGGATCT
CAGAATTTTATAAGGAGTTTTAGGAAAAAGCTTATGAAAGATTTCTAAAATTGCAACTAG
GAATAAGATTGTAGGCCATTTTGGGAAGTTAAGTAGGTTAATTTGTAGTTCCATTGGTTT
AATGATATTTTTTGTTGTTGAGTCTGTGCATCTTGATTTATTAACTTCTTAGGAATATTT
TAGCATTTGGTGATTTAACCAAGAAATAGTAATTTTTGGTAAGCCTAAAATACAACCCAA
CTGAAATTTTGCTTTTATGATGTGGAGGTGGGTGGGGGGAGTTAGTTGCAAGTACACCAA
GAGCATTCTCACTTGACAATTTCATTAACTGTGATCTTGGACAAATCACTTATTCCCATG
TACCCACTGAAAATTAAAGGATTTAGAGTATAAGCTTTGAAACTCCTTCCTGTGCTGATG
TGCTGGATAACTAATTTTGTAGTGGTAGAAAGCCTTGGTAATGGCTTTTAAAGGTGTTTG
TAGTATGAATTTCTTTTCTGTCCTGGAATTCTGAGATGAGCTGCTGAATGATGATATCCC
ACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATGATGCGATAATTGTTTCAAG
ACGGGACTGATGGCAGCTACTAAAGTAAATTCTTACTAGTAAACTAAGTTGAGTCTATAC
TAAAATATGAATAACTTTATTTTAGTACCAAACGATTCCCTGGTTATGATTCTGAAAGCA
AGGAATTTAATGCAGAAGTACACCGGAAGCACATCATGGGCCAGAATGTTGCAGATTACA
TGCGCTACTTAATGGAAGAAGATGAAGATGCTTACAAGAAACAGTTCTCTCAATACATAA
AGAACAGCGTAACTCCAGACATGGTAAAACATTTACCTAAAAATGCCTATATTGGTTAAT
TTATAGAAATAGGTTTATTACTTGCTTTGGGGGCAGGTAACATTCTTATATAGGTGTGTT
TCAGGTTAGTACTGAGCTAGACTAGTCAACATTCTTTTAGTAATCTTTTAGGTGCTCAAG
TGTGGGAGACTTCAAGCATCTGAAGATTTGGCTACCTTTTATGCTTTGGCTGTTCTGTAT
TTGTAGATGTCATTTCTGTAATCATAGTTGTAATCTGCTTTGTTTGATAGGAGGTGCTAG
ATAATAAGCTTCACTTATTTTGATACCATCTGGGAGGAAAGCTCTTCATAGCATATGTGT
GGTGTATTCTGGACTTCCCAGTTATCTCAGACATGTACACAGGAAAAGAGATTTGATCAC
TGGGTCTGCATGATGTTGTAGAAATGAGGGGAGCCATGTTTGCAAGAATGAGTCCCAAAA
TGCTGGGCTTACAGATGAGAGCCGTTCCTGACCCAGGTTCTTTTTTGTTAGTGTGTAGTA
GCTTCTATTTTGGCATAGCTATTGGTTAGGAAAATTTTTAAAAACAGTAGTTGGGAAATG
ATCACTTTCTGTTATTTCTATGCTTTGGACATAGTGTAAAGGCTGAATAAACAAATAGCT
TGAGTTTCTGAGTTAGGAAAAGGAATAGTTTTTTTATCAGTAATGTAGGTGCACGTTAAT
TTTTACTGCGTTATATTTCTTTGTTACTTACGACTTCATCCTGGTAAAGAGGTCATTTAC
TTTTGGATTATGATTCTACTAGTCTTGCAAAATCTACTTCCTAACCTATATCTTTATGTA
GTCATGTCATACTTGCTCAGAACTTTTCAGACTCCCAGTTTGTGCTTTCAGATGTTTACT
TCCTAATGCTTTCCTGTATACATGCCTTCCTTCAGCTAGACTACTTTTTGGCTAATGTAT
TTTTCTAGCTGGCTCATTAATTTTATCTACAGTGGCCTCTATCCTCCTGTGTGCCTGCTG
AAATCCTATGCAGACATCTGATGTGTCTCCAACAGGAGGTGGTCTTTACCTGAATTCAGG
CATTATCTACATGTCTACTTGTCTGACGTCTTGGAAGGAACTGGGTTGCTTAGATTTGTT
GAATGACTATATATGAAGTCATCAAATGGATTTGTTATTTGTTAGTGAACAGCTATAATA
GAGTGCTAAAAGAGGTAGGGAAATTAATTTTCAAAATGGGTATAGGTCGTTGAGGTTTCA
AATGCAGTGAGCATTTTTGCATTATTTTCCTTTAATAATCTTTATGCAAATGCGTGTAGT
AATCACATCTCCACATTGAATGAATAATTTTAGAGACCTGGATTACTGTGACATAATCTG
TAGTGGGCTATAATTATTAGATATTCAGAGAGTTGCAGCATTTTTTTTTTTTTTTCAGTG
AGTTTTAGAACAAAATTGCCCTGGCCGGGCATGGTGGCTCACGCCTGTAATCCCCGCACT
TGGGAGGCCTTGGTGGGCAGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAATA
CGGTGAAATGCTGTCTCTGCTAAAGATACAAAAATTAGCTGGGCATGGTGGCTCACTCCT
GTAATCCCAGTGACTCGGGAAGCTGAGGCAGAAGAATTGCTTGAATCCTGGGAGGTGGAG
GTTGCACTGAGCTGGGATTCCGCTACTGCACTCCAGCCTGGGCAACAGAGTGAGACTTCA
TGTCAAAAAAACAAAAAATTGCCCAATAAAATATCTGATCGGTTGGCTTTTCAGGAAAAC
TTCTGACGTCTTTCTGGTCTAGAGGCCTTATATTACCACTAGATACTAGGGATGGATTGG
TGGTAGTGAAAGAAGAGAGGTCCTTCGTACATAATGCTGGGAATTACTTTTAAAGGCCTG
TGAGATAAAGATGGAAAACAAAAGTCTAGGGATTGTGGGATGACAGATGAATTTGCTTGT
TGGCCTGTGTCCAGTCCCTGGTCTCAGTTAAGCTATGTCAGTGTTGTGACTCTTGGTCCC
ATACATTCATCATCTTGGCACTTGTTCTTGAATGAAAGAATCTAGGCCAGACAGTATTTA
AAATGAGAAGCGCAATATTTGTTTCTGCAGACAAAAATTTGATTTAGAGTGACTCAAGAA
GTGTGGCTGAATTTCTCAGAAGTACAGGCAGATTTTTCTTTTTGTTTTCTTACTTTTTTT
TGAGGCAGGATCTTGTTCTATTTCCCGGGCTGGGGTGCAATGGCACAATTATAGCTCATT
GCAACTTCAGACTTCTGGGCTCAAGCAATTCTCCCACCTCAGCCTCTCGAGGTAGCTGGG
GTTATAGGTGTGCACCACCATGCCCTGCTAATTTTTTTTTAATTTTTGGTAGAGATGAGG
TCTCATTCTGTCACCTAGGCTGGGGTCCAGTGAGCTGTGATTGTGCCACTGCAGCCTTGA
CCTCCTGGACTCAAGTGTAGTCCCGTAGCTGGGACTACAGGTGCATGCCACCATTAATAA
TTGCCACCTGGCTAATTCGTTTTTTTGTGGAGACAGGTCTCACTATGTTGCCTTAGCTGG
TCTCAAACTCCTGGGCTAAAGTGATCCTCCCACTTCAGACTCCCAAAGTGCTTGAGATTA
CAGGCATGAACCACCACACCTGGCCTGATTTTTTTCTTGAGTAAGATGGCGTTCTATAAA
TAGTGATAATTCACATTGCATAAGGCGAAAATTGGGAATTTGTTAGGAAAAGGTGAGTTA
CATTTAGAAGTTAAAGTGTTTACCAACATTGATTTAGTTTAGTTCCTTTTGAGAATCTGG
CTTAGAAGGACAAAATAAGTTATGGTTACATTAATATAGTAGGGCATATGAAATGAAACC
AAGTACTGTTTGCTTTCCTTTGTTTCAGATGGAGGAGATGTATAAGAAAGCTCATGCTGC
TATACGAGAGAATCCAGTCTATGAAAAGAAGCCCAAGAAAGAAGTTAAAAAGAAGAGGTA
TGTCGTCTTTTTTTTGTCTTTTCAAGAAAACAGGTTGGGAATGGTTCCCACGTGGGGCAG
ACTGTTGGTGTAATTGTGCAAACTCGATCACTAGCTCTGCATGATGTGGCAGAAGCGAAG
GGAACCAGGTTTGCAAAAGTAACTGTGGTGATGGAAATGTGTTAGCCTCAGACACTACTG
AGGTGGCTCTTTCTATCCTAGTACAGTCTGAGTACTGGTTATTGCATTTTTTTATTGGCT
GACAAGTTGCTTTTTGTTGATCTTTCATGTTTTGATCTTTAAATGGAATAGAAAGTAATA
CTTAATGAACATGTAAGCATAAAGTGATGTGATGGCCCACAAATACAATGTGTAGTAATT
AAATCAAAGTATTTAACATATTCACCTCAAATACTTAACACTTTGTGGTGACAACATTTG
AAATTTATTCTCTTAATTGTGAAATGTACGATATTCTGTATTCATCATGCTGTGTAATAG
AACTAAAAAAAAAACCATATTCCTCCTGTTGGAGATTTTATACTTGACTATTATCTGCCC
ATTCTTTGCACCCACCAGCCTCTGTAACCACCATTCTACTCTCTGCTTCTGTGAGTTCCA
TTGTTTTAGATTCTATATGAATATGAAGTATTTGTCTTTTTGTGCCTGGCTTATTTCACT
GAGCACAATATTCTCCACTTCCATTCATGTTGCAAATGACAGAATTTCCATCATTTTTAA
AGACTGGGTAATAATCCATTACGTATATGTATACCACATTTCCTTTATCCATTTATCTGT
TGCTATTAATATATAGTGCTGCAATGAACATGGGAGTGCCACTCTCTTGGACAAACATTT
CAAAACATTTGGGAAAATACCTAGAAGTGGGATTACTGAATCTAACATGTCTTCTATTTG
ACTTTTGGCCCTATGGTAGTAGGACATCACAGAAGTCGGGGTTTGGGAAAGTTAGCTTAA
GATCATACATAAGTAAATGTATTGGATTATTTAACCTCCTTCTGATTGCAAAGTCTTATA
TATTCTCTATCAAAATTAAATTTTATTAACATTTTATCAAAATTAAAATTTTAAATTAAA
TATTCTCTATTCTGTTCAGTTATAGTTTAAAAAATATATATTCCTATCTTTTATAGGTGG
AACCGTCCCAAAATGTCCCTTGCTCAGAAGAAGGATCGGGTAGCTCAAAAGAAGGCAAGC
TTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCCAACAATTTTCTATGATTTTT
TCAGATATAGACAATAAACTTATGAACAGCAACTATTTCTGTGTTAAGCTCTTATTCTTA
TGAACCTTATAGGAAATACCCTGAAATATTTTGTAAAAGCAAAGGAGTTGACAGGTTTTT
TTCTCCAAGAAAACAAGTGTAACTTTTTAAGAAAAAGTTGTTATTTCTTGGGCTTCTATT
TTACCTGACAGGAGTCATTATCCCTTATGTTGTATGATGAACAGCTCTCCCTAAAAATCT
GGCAAGCAACAGACCAGCCATCACTGGGAAATATTTCTTCCATCCATTTATTATAACCAG
ATGATTAATGGGAAAAGTACCTTAAACAAAACTGGTGCTAATCCATGGCGTTGAAGGAGA
GTTTTGAGAGAAAGCTGTCCAGTGAAGGTCACATAGATTTTTAACACATCCACTTTAAGT
AGGTGAAACCTTTGAGCAGAAAATACTGGATCTTTTCTCCAAAAGGTGTTTAATTTTATG
GAGATGTTGAAAGGTACATGCCAAATCTGAGTATACATGTGAAAATAATATGAAAGAGGA
GCAAATACTAAACCTTGTATATCAAGTTTACATGGGGAAAAAAACATGAGATTAATACAT
TTACATGCCTCTTTAAGAAATAGCCCTTTGGCCCACAGGATATACTGTTTGAAAATGGAA
AGTTATTACTGAAAAGTCTGCTATAATTTATTTTAGTCTTGCACTTACAGTCCCACTTTC
ACATAGTTCAAAATCAGGATATGTGGATCTTGATTGGGCCTTAAGATGTCAGTTTTGAAG
GGCTCAGTCAGCTGCGTGATACTAAGATGGGCCCTTTGAATCTTTAGGAAAGTTCATCCA
TTTTTAGTCAATAAAATTGGTGTACTGTCAAGTATAAGATTTCTTGAAGTAAGCCACTTG
AACCATTGTGAAGCTACACATAACAGCTGATGTCTGAATGAGGTTAAAAATGGGTGTATA
AGTCTTTAATACAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2279..2348, 2435..2550, 3673..3807, 5123..5325, 6385..6562, 9448..9536, 10676..10775
1001..1003, 2279..2348, 2435..2550, 3673..3807, 5123..5325, 6385..6562, 9448..9536, 10676..10772
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved