Pongo_pygmaeus Locus Poly:3:SNORD74
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:3:SNORD74
Pongo_pygmaeus
Poly:3:SNORD74
1
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1080, 1793..1852, 2015..2096, 2363..2430, 2708..2768, 3048..3112, 3309..3383, 4298..4374, 4521..4597
5597
AGGTGAGAACTAGGAAGGGGGCGGCGCCCGGGGACCGGCTCCAGGCGGCGGCGGCGGGC
GGGGAGCTGCCGGGAGGTGGGTGTGCGTATCTGGGTGTGTCCCAGCTGCGGTGGGGAAGG
GGGCCGCCCTTCCCGGGGTCCTGAGGGAGGGGCCCCGCGAGGGGGCGGGTCCGGCAGATC
AGCCCGGCCGGGGGCCAAGGGGGTGGAAGGTCGCCCGGTGCCTGGAGGCGGGGTGAAGGA
AAGTAGCTGAGCGCGCTGCGGCGGAGGGCGGGCGAGGTGACCCCGGTGCAGGGAAGTGGC
ACTGGGGTGTGGGGCCCGAGTCCAGTCAAGGAGCAGCACCTACCTCCGGGGGTGGAAATG
GGCCGGAATGGGCCGGAACACCGTCCCGGAAGTGAAACCCCCCACCCCCTCCCACGGAGC
GGGCGACGTGCCGGAAGGAAATCACTCAGCCTTACACCGCCCCCCCTTCCCCCACCCCCA
GAGCTTTCGTTGCTTCGCGCCCCCTCCTCTCTCTGCTCTTCCTCCTCAGTCGGGAGGAGG
GCGGGATCACGGCATCACGTGGACGGTCATGTCTCTGCCCACAATGGCGAGGAAGGGCGG
GGAAAAGGGGCGGATTTAGGGGGTGGGAAGAAGGTGGTATTGGATGAGGGGAAGATTGAG
GGAGGTTAGGGGGAGGAGCCGAAGCGGACGCTGCCGGGAGCGTGCGTCGTGACGTCATCA
AAAGACCTCTTATATACAGGAGCCCAGGCACCATATTGTCTTTTCGAGGTGGGAGTCTAC
TGAGGTGAGGTATGTTTTATCTTTGCGAATGTTGCGGGTTTTTGGTCCCTCCAGCCTTTG
TCTGCTAAGATCACCCTGAACTGACTGGGACTTCTAAGCCAGTCGCGCGCCTTTGCAGGG
CCTATAAGTTGAGGATGGTGGGGGATTGCACATATGGTGCATGCGTGACCTAAGCTGCGA
TTATGTTGTTCGAGTAGAACTGCGGAGAAGCCTCGGCTCTCGTGCCCTGCCTCTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGAGTGATGATGAATGCCAACCGCTCTGATGGTGGCA
CATGCCGAGTCAACCGAGTAAGCTATTGTTAAGGGCCGTGACCCGAGCCTCCATCAGCCG
CCCGCTCTCATGAAAGGCTGTCGGTGGTAGTCCACGTGCTTCTCTTAAGTGCCTGCATTC
CGCAGTGTCACCAATATTTCCATTAGTGTTTCTTTTGTCTTTTTTTTAAGACCGAGCCTC
GTTCTGTCACCCAGGCTGGAATGCAGTGGCTCGATCTCGGTTAACGGCAACCTCCGCGTC
CCGAGTTAAGCAATTCTGCTTCAGCCTCCCAAGTAACTGGGACTACAGGCGCGCGCCACC
ACGCTAGGCTTTTGTATTTTTAGTAGAGACGGGGTTTCGCCATGTTGGCCATACTGGTCT
TGCACTCCTGACCTCTGGTGATCCACCAGCCGTGGTCTCCCAAAGTACTGGGATTACAAG
CCGTGAGCCACCGTGCCCGGCCGCCATTGGTGATTCTTAACTGCGGGTGCAGTGCTCTTT
TGTAACATTAAGTGTATCCTTTACTTGTCGCTAGATAATGAATGGTATGTTACCTACATC
ATTGGTTTTAAAAGACGACATAAAGAACCGTGGAACAATGAATTAAAATCTGTACCCGAT
CTCTTTAGGTATGGTGCTGGGTGCAGATGCAATGTGGCTCTGGATAGCACCTTATGGACA
GGTAAGAATCGGGGAAAGTATGGTGGGAAGAATGAAATCTAAGAGGTGGTCTCAGCCTGT
GATGCTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAATTCTATTCTGAGGCTTTAATGT
TAACAGTATTGATATTTAACGTGACTGCTGTGAGGTTCATTCTGTTTTGCTTGCATCTTT
TTGTTTTCTAGTTGTGTCCCAAAGGAAGGATGAGAATAGCTACTGAAGTAAGTTGAAAAT
CTTTAAATCTCAAAAAGATTTAAAGCCATTGGATGTGCCACAATGATGACAGTTTATTTG
CTACTCTTGAGTGCTAGAATGATGAGGATCTTAACCACCATTATCTTAACTGAGGCACCC
AAAATGGTGATTTGGGGAACAGAGAGAGTACACCTAAGTTCACACGAAGTTGTTTCTTCC
CAGGTCCTAAAGAGCAAGCCTAACTCAAGCCATTGGCACACCGGTGAGAAACCTCTATAT
TGTACTTCACACTTTTAAGGGATTAGAAAATAGCCAAAGCAGTGGTGATTATCTATGTTA
GTGTTTGTCTCCCCCCCTTTTCAAATGAGAATTTTGCTCTCATATTGATACTAAGTTTAA
TACTGAAGAAAATGTGAAAACAGATACTATGATGGTTGCATAGTTCAGCAGATTGAATCA
TGAAGAGATGTACTATCTGTCTGATGTATCTGGGGTGGTTGTGGTTTGCTGTTAATGGTT
AAGCAGTGTACCACCAATCTACCATTAAAATATTCTTTGCTGACAATTTTGTATTAAAAT
TACAGGCATTAGACAGAAAACTGGAAGTTGAAATGGTAAGTGAAACTATGTCCAAGTAAA
CAGCTAACTGGGCAAACTGCCTACAGCACAAATGGCTTTTTAGGGTTACCTCCTACTAGT
GCTGAATGCATTAAATAAATGGTGGATTCTTGTCTTGTTATGATTAATAAGAAAGTTTGT
AAATGCAGCCTGGATGATGATAAGCAAATACTGACTGAACATGAAGGTCTTAATTAGCTC
TAACTGACTAAAGGCATTTGTTAGTTTTGGCAGGGGGAGAACACTCACCTGTGGCTATTC
TAAGACCACTCTTATTTCTTAGGTGGAGTCCAACTTGTCTGGACCAGCTTAATGGTTCTG
GTACGTATTAATGAAAACAGTAGATAGACTTAATGAAAATGCTGATAGTGATATACTTAC
TGCTGAGCTAATGGCTTAAGGCTTGGCTGATGAATACTGACTGTATTTTCCTTGAGCATG
TTTGGAACGGTGTTTGTGTTTTCCTTGAGCATGTTTGGAACGGGGTTTGTGTAATGATGT
TGATCAAATGTCTGACCTGAAATGAGCATGTAGACAAAGGTAACACTGAAGAACCCTGTG
ACAGACAACTTTGAAAAGAGTTTAATGATGTTTAGCATTTTAATGGAAGTCCTCATTTGT
ATTCCAGCTCCTGGTAACGTTTTTATCCACGGATGGCTTGCTTGGGTAAGGACGTGAAGA
CAGTTCCTGTCATACCTTTTTTAAAGGTACATATTTTGTTGATGTTAATGTGAATTGATT
GAGCTACTGTTAGTGATGATTTTAAAATTAAAACAGATGGGAATCTCTCTGAGAAAGAAA
ATGGAGATTAATCTTAAACTGAAACAGTAGTTGGGAAATCTTTTAGAAATCCACCTATTA
CTATCTATTGGTAAAGGAGATTATAAATTTCTGCAGGTATGGAGAGTCGGCTTGACTACA
CTGTGTGGAGCAAGTTTTAAAGAAGCAAAGGTATAGCAGTCCCAAGTTTTTTTTTTTTTT
TTTTTTTTGAGACAAGAGCCTAGCTCTTACGCAGAATGGAGTGCACCGGCACTATCAGCT
CACTGCAACCTATGCCTCCCGGGTTCAAGGAATTCTCCTGCCTCAGCCTCCTAAGTAGCT
GGGATTACAGGCATGTGACACCATGCCTGGCTGATTTTTGTACAGCTATGTTGTCCAGGC
TGGTCTCAAACTCTTGACCTCAAGTGATCTGGCGACACTGACCTCCCAAAGTGCTGGGAT
TACAGGTGTGAGCCACTGCGCCCCGCCTCAAGTCTGGTTTTTAAGTGTTGTAAAGCCGAT
ACAATGATGATAACATAGTTCAGCAGACTAACACTGATGAGCAATATTAAGTCTTTCGCT
CCTATCTGATGTATCTGGCGGTAACATTCTAGTTTATGCCCTGAAAAGGGGAATATAGCC
ATTCTATAACGTTTGGAGATTTTGGATTACTCCTAATTGTATGCAAGTTGTCTTACTGTG
TATTGTCCCTTAATTTCAGGACTCAGAATTCATGCTTGAAGAAATGCAGGTTAGTTTAAA
CTTTTAAGGAAATTTTTAAGGTGGCAAAAGGTTTTGGTGACATATACACCTTAATCTGTA
GATGGGAGTGATTAGCTGTTTAAAAGTTAAAATGTGACTGAGAAGGAAATTGAGTAGGGC
AAATTTTAAATGGGTATTATTTTTCATCTTCAAACAGGCAGACCTGTTATCCTAAACTAG
GTGAGTCAGCTTTTGGTACATGTGATGATTTTCAACGTAACCAATGATGTAATGATTCTG
CCAAATGAAATATAATGATATCACTATAAAACCGTTCCATTTTGATTCTGAGGTTACTCT
ACTAACAAGCATCACACATTTGCTTTTTGCCATGATTAATATGTTGGCTTTGCTTTCAGG
GTTTTTAATGACCACGACAAGCAAGCATGCAGCTTACTGCTTGAAAGGTGAGGATTGTAA
ATGTTGGGACTATTATAATCGCAGAATACATGATGATCTCAATCCAACTTGAACTCTCTC
ACTGATTACTTGATGACAATAAAAGATCTGATATTCTGCATTCCCATGTAGCATTTTAAT
TGAAGTCTGTAAATGTGGCTAAAAGTCTTATTTTTTGAGACAGGGTCTTGCCTCACCCAA
GCTGGAGTGCAGTGGCCTCTGAAGCTTACTACAGCCTCAAACTTCTGGGCTCAAGTGATC
CTCAGCCTCCCAATGGTCTTTGTAGACTGCCTGATGGAGTCTCATGGCACAAGAAGATTA
AAACAATGCTCCAATTTTAATAAATTTTTGCAATCCATCTGGAGTGTGTAGTGTTTATTT
CAAAAAAGGACAGTGCTTTTCATCTGTTCATTAGTTGTAAGCATAAATCACATTCAAAGG
CTATTATAATTCCATGGCATTTGCTTCATTAACACTGCAGCCAGTTAAAATTTTATGGGT
ATTTTACAAGGTGTCTTATGCATTAAAGTGCAATATTTCCTAATTCTCCATATGAGCAAA
TTGTCAGGTTTCATAGGCCGCTGTGCTAATTGGTTTTGAGCTTAAAGTATTGATGGAGCT
ACTTTGGAGAAAGTCATGGTGAGTCTGAGGCTGGGAAAATAAGTTACAGAAAACACTATA
GAAATGCCCAATTAGTGATAGGAATTAATGGAATTGGGAAAATCTACAATCCATAGCCAT
GGTGATAGGTTTTTGGCAAGCAAGTGTTTAGGGATGCCAAAAGTGGGTAGAAGGGGCCCA
ACTGGTTTAAGGCAATCTGCCCCAGGGAAACGGGACCAAGGGGCCAAAATTCCAAGGTAG
GTCAATTTTAATTTCAGTGTCAATACAGCTGTGCTTATAATGATGTCTTTGTTACCAGTA
GTGGTTTTACAAATCTGTTTCTGGGCTAAAGCACTTTAGTCCCATTAATGATAATAAAAC
TTCAGTTACCCTCTGAATTTTCCTTTTTTTGAGACTGAATCCTGTTGCCCAGGCTGGAGT
GCAATGGCATGATCTCAACCACTGCTCACTGCAACTTCCACCTGGATTCAAGCGATTCTC
CTCAGCCTCTTGTAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved