Pongo_pygmaeus Locus Mono:148:SNORD64
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:148:SNORD64
Pongo_pygmaeus
Mono:148:SNORD64
15
SNORD64
1001..1067
2067
GAGGCAGGAGAATCACTTGAACCTGGGCGGCAAAGGTTGCAGTGAGCCGAGACCATGAC
ACTGCACTCCAGCCTGGGCGACAGAGTGAGACTCCGTCTGGAAAAAAAAAAAAAGAAAAA
AATGAGATATAAAGTTCAAAGGATGTATTTATTAAGCCAATAGAAAGTAAAGAGGTGGGG
AATGTGGTAGAAGTATATGTTGATAAAGGGATCAGGTGGTTGTACAATAAGAAGGGGGTT
GCAGACTTGGAGAAACAGTTCTTCTAGCTCTTCCACTTTCACCAGCATCTGTGTGGGTCA
CTGGAATCCTTTTTCACAATGCCTGCTTGCCCATGTGTTTTAAGAACTAGTACAACGTAG
AAATGATTAGTAGGAAAAACTTGGCTGGGTTAATTTGCTTTGCTGAGCCGATTCAACTTA
AAAAGTAAGGTCCATACGAAGCGCCCAAGATTCAAGAAGGAGCCTCATATTTGAACTTGA
TGTTTAGTTAATGTGAATCATTTTCTGTTGAACTAATGAGAATACAGTGACCTTGAGGGT
TAGGTTGTACATCTGAATTGTTCGGACTGTTTCCCGTCTTTTGTGATGTTTTGTTTGTAT
AGATATTTTCATTTTATGTTACATCATTTGTCTTTGGNNNNNNNNNNTTTGCTAGTGGAA
ATAGTTATTGTATTTAGCTCTATGAGACCCCATAGGGAGATTGCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTTTCTGTGTGTGTGTGTGTGTGTGTGTGTTTCCTTCATGTAGATTGCT
GTGTATGTCTTTTTCTTCATAATTCACCTTAATTCTGTGTGCTTTGAATGATACTGTTGT
TGTTACTGTTGTTTTACATCCATTGTCACATAAAACTCTTATCATTTATTCTTCCAGGCC
AGCGACTGTCCTTATGGGTTAGAGGTACACTGTCTGCAGGAATTTATTTTTTTACATATT
TTTACTAGTTGATGGGAAAGACATTGGGAAAGACCTGGGCTGGATTTGTGATGAGCTGTG
TTTACCGAGCATGATGAAGTAAAGCTCAACGTGATTACTCTGAAGTCCAGCCTTACTACC
AATCTAAAGACTCCAGGACACAAATACTCAAAACATAAATTCTTAGACTCTAAATTTCAC
ATGGTTTTTCCTACCAGTACAGGTTAAGGATAATGGCGTGTTGTAGGTTTTTCCAGTGCA
ATACAAGGAAGTTGGTTCTAGATCCTTTAGTACAGTTAATGTTTTGTAGAGTGTGTTCTA
TGTTCACTGCATTGGTATGTCTCATCTTTGGCATTTTCTTGGCTCACTGCAACCTCCACC
TGTTGCGTTCAAGCACTTCTTGTCTCAGCCTCCAGAGTAGCTGGGATTACAAGCATGTGC
CACCATGCCCGGCTAATTTTTGTATGTTTTTGTGGAGACAGGCTTTGCCATGTTTGCCAG
GTTGGTCTCTAAGTGATCCACCCGCCTCAGCCCCACAAAGTGCTGGGATTGCATGCGTGA
GCCACCGCACCCAGCCACACCTTTGCTTATTTCTACTATGCATTTCAAATGATCACTTCA
AGAGAATAAGTACTTAGGAGCTCCTATGCTCTTTTTTTTTTTTTTTAACCCTATTGCTTG
CATCACCTGGTTGCAACCCTATATGAAAGTTTCATGAGCATGTTTCTGGCACTGAGGCAG
CTTCTCCATTTGGCATATAATTGAGAAATTGCTAGTTTGTGGCTGAGACATTGGTTTGAG
AGGAGACTTAATTTATATATTTAGCAGAATGCTTAAGTTACACTTACAGAGATTAATTTA
ATTCTACTTTAAGTTAACCCTTTGCTGTATCTTTACAAGACGTAGGTGGAGATTTAGTTT
TGAGTCTTAGATTCAGTTAAGGTGATGAAATTGGCATTATATAGTTTTTGATGCTGAGCC
CCACGGAGATTAAAAGATTTGCTAAATACCATGCAATTTTTGAATCACATCTCTAATCTC
ACATTATTCTATACTCTATTTTTGTTTGTATGATTGATGGGTCTTTCGTTATCTGTGATT
GACATTCTATGAGTAGGCGCTTTTGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved