Pongo_pygmaeus Locus Mono:114:SNORD50
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:114:SNORD50
Pongo_pygmaeus
Mono:114:SNORD50
4
SNORD50
1001..1071
2071
AATGTTTATACAATAATGGTGCTGAAAGAAACGTTTTTTTTAAATTTATTTTATTTTAT
TTTTTTATGTCATTTTTGGGTTTTATTTCTCAATTTTATTTCAAGAAAAAATATGGAGAC
CATAAAGCCATCTTCAAGTACCAGAGGTTTGTCATGTATTAATAAAACGGGGGCGGTATT
TTGTGCATAAGATATATCTCCAATTTTAAGTATTTTGTTCTAACTTAGACTATTTATTTC
TGGAAGTACGGCCACCATGGTAGATGTCTTTAAATGTATGAAGAGCTGTCTTGTTGTTTT
TTGTTTGCTTGTTTTTTGTTGCTGTTGTTTTGAGATGGAGTTTCACTCTTGTTGCACAGA
CCAGAGTGCAATGCATGATCTCGGCTCACTGCAACTTCCGCCTCTCAGGTTCCAGTGATT
CTTCTGTCTCAGCCTCCCAAGTAGCTGGGATTACAGGTGCGCACCACCACGCCCGACTAA
CTTTTTATATTTTTTAGTAGAAACGGGGTTTTGCCACGTTGGCCAGGCTGGTCTCGAACT
CCTGACCTCAGATAATCTGCCTGCCTCGGGCTCCCAAAGTGCTGGGATTACAGGTGTGAG
CCACTGCGCCTGGCCAGAGCACTCTGGAGGCTGGAAGTTGAAGATCGAGGCACCAGCAGG
TTTGGTGTCTGGTGAGGGCCTGGTCTTTACTTCCAAGATGGAGCCTTGTTGTTGCATCTC
CTGGAGGGGGCAAAGCTTACACAGGTATGGAGGGATATTTCAATATTTCAGTGTAGGTTC
TTTCTATTTTCCCTAAGTGTCGGCCAGTCCCAAGTTCCATGGCCAAAATGTGAAGACATG
TTTTGATTCCTGGATTGGAGTTCTTTCCACCACAGCTGTCACCTGTGTACTTCTCAAAGT
GTGGGCCGCAGATCAACCGAAAGAAACGTTTTTAAGCAGACCAGTAAAACAACAGATCAG
TAACTGAGAATAACCTCTGCATGCACTAAAAGAATGAGTTACATCTGTGATTATCCTATT
TCAAACCTGAATTTCTACTAGAAAAAACTTATATGAATCTGGCTTCTGAGATAGACCATT
AAATTGAAAAGAAAAGAAGAATGAGGAGAGAGAGGCAAGGAAGGGAAAGTGCAGGTCATT
TGCCTGATTGCCCTTGAATGCATTCTCTGTCCTTCCCCTTCTCTGTTGAGTGTTGTAGGT
TCCCTTTCTAGTTCTCTTCCGGGTAGGTTTGCAATGGGAAGAGCTGGCAGAAGAGCTGGA
GGCAGCAGAAGAGGGGAAGCCAAGGTTATGGTCCTCTCACTGTCTCAGATGAGGATCTGG
TAGTTGGTGGTGGCTTCAGCTCCTTCCAGGCAGCCCTCTCTGTGGTTCTACCTCTAGCTT
CCATGCCCTTGCAACGGCTGCTTTTCTCATTTTCCTTCTAGCCAAAGGCATGATTGGTAG
CAGCTTCCTGCAGTTGGTAATTTCTGTGTTGTTTCATCCCTTTAGGCTTTGCAGCTCTTT
CAACACCTATGTAACCATTCCTTGTATTAAATTCCAACTATTTATTCCATCTGTGTCTGT
TTTCCTGACATAGGAATCACCTTTGATTGAAATAATTTGGATCAGAGGTGATAGGGGCCT
GAACCAGAACACCAGTAATGGAAATGGAGAGGGAAAAAATGAATTCAAGAGACATTTCAA
AGGTAAAATCAGCAGGGCCTCAGTACCTGACTGGATGTAGCATCAGGTGAGGAAAAAGAA
ATGAGGTGATATAAAATTCTGACTTAGGGCAGACCAAGGAAGGCAGACTAGGAAGACACA
GGAGGAAGAGAAGGCATTAGGGAGGCATGGTACATGTTGAGGCTGAAGTACCTCAATGTA
GAAACATTTTTAAAACAAAAAGTTCCTTAAAAGACAAAGGAATCTCTTCTTCAAAAAGTA
GAATTATGAACAATATGGTAGACATTCATGATCATGGTCTGTAACTCACATGGTTAAAAA
CAAAACATACTAGAAACAGCAGTTTGAATGAATATCATGGTTAATTCTATTTTTTTCCCA
TTTTGTTTTATAAACAGCACATACCTCCATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved