Pongo_pygmaeus Locus Mono:343:SNORD41
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:343:SNORD41
Pongo_pygmaeus
Mono:343:SNORD41
14
SNORD41
1001..1069
2069
AGTTTCTTTTGCTGTGCAGAAGCTCTTTAGTTTAATTAGATCCCATTTGTCTATTTTTG
CTTTTGTTGCCATTGCTAATATTCTTAAATTATATTTAATATCAAACATTCTAAGAAATC
ACTCTGTAATGAATGTAAAACCACTTTGGGTAGAGAGTATGATACCAGTAGTTCTATTTA
ATCTTCCTTTTAAACAAATACATATTTATTTTTAAACATGGGTTTTTCATGTTTTTTTTT
TTTTGGTTAAATTTTCAGCAATGTGTTTAATACTCCAGGATACCAAAAAAAAAAAAAAAA
AAAAAAGCCTGAGGAATTTATAGTCTAGATATGGAGAAAATACCTATACATGACATGATT
AAAGTACTTTTAAGTAGAGTGTGTAATGAAGTTTGAGGTAACAAAATACAGGGTAACTGT
GAGGGTGAAATTGACATGGGGTCACAACATTCAGGGGACATTTATGAAGGAGGAGTGTTG
GTGAGATTTTAGTTGGTGCTTCCAGGCAGAGGGAACAAGACAGCAGGCCTGGAAGCAGTG
ATGAGTCGGGTATGTGGAGGACACTGTGAAGACTGGCCTGCAATAAAGTTTAACCTGTAA
TTCCTTTATAAAGATTTCCACGTAGGAAATTAATCACAGTTATATTCATAGAGGTTCATT
ACAGTGTTATTTAAAATGATGAAAATTGGCCAGACGCGGTGGCTCACGCTTGTAATCCCA
GCACTTTGGGAGGCCGAGGCAGGTGGATCACGAGGTCAGGAGTTTGAGACCAGCCTGGCC
AATATGGTGAAACCCCATCTCTACTGAAAATACAAAAATTGGCTGGGTGTGGTGGCATGT
GCCTGTAGTCCCAGCTACTCAGGAGGCTGAGACAGGATAATTGCTTGAACCCAGGAGGCA
GAGGTTGCAGTGAGCCTAGATCACACCACTGCACTCCAGCCTGGGCAATAGAGGGAGACT
CTGTCTCAAACAAACAAAACTCCAAAAAAGATGAAAATTGGGGGGAAGTGATGACAACTG
TGACTGTTGTGTGACACTGATTTCTCTCATATTCGTACTGGCTGATCCTGAGGTGAGTCA
AAAAAAGACAAAAATGTATAAAAATAAAGAAAAATAAATAAAATGATTAAAAATGGAAAC
AACTGACATTTTAATCAATAGGGGAATAGAAATGACTTAGACTGTATTCATTCAGTAGAA
CAATATGTAGCCATTTCAAAACATGTTTTTGATAACAAGGTGGTAAAATGTCCATGAGGA
AATAAAAATGTTCAGGCCAGGCGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGG
CCGAGGCAGGTGGATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAACGTGATGAAAC
CCTGTCTCTACTAAAAACACACAAAAAAATTAGCCGGGCATCGTGGTGGGCGTCTGTAGT
CCCAACTACTTGGGAGGCTGAGGCAGGAGAAAGGCGTGAACCAGGGAGGCAGAGGAGGTT
GCAGTGAGCCGAGATCGTGCCGCTGCACTCCAGCCTGGGTGACTGAGCAAGACTGTCTCA
AAAAAAAAAAAAAAGAAATAAAAATGTTCATAATTATGTAAAAGAAGCAGAATATAAAAC
TGTAAGTACACTATGATGGCAATTTTATGAAAATGAAAAAATATGCATATCTTAGAAAAA
AAGCCTGGAAGAAAATACTCCAAACATTTACTTTAGTATAATTTATTTATTTATTTTATA
GAGACAGTGTCTTCCTATGTTGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGTGATCCT
TCTGCCTCAGCCTCCCAAATTTCTGGGATTACAGGCATGAGCCACCATGCCTGGCCTCCA
AATATTTTATGATGGTTATCACTTGTTGATGGAATTATAGGTGATTTGTATTTCCATCTT
TATATTTTTCTGTAATTTTAACATTTATTGTAATGATTACATATTTTGTTTATACTCTCG
GATAATATTTGTATTAGTTTGCTAGAGCTGCCATAGCAAAATACCATGCACTTGGTTGCT
TACACAACAGAAATTCATTTTCTCATAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved