Pongo_pygmaeus Locus Mono:346:SNORD58
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:346:SNORD58
Pongo_pygmaeus
Mono:346:SNORD58
14
SNORD58
1001..1066
2066
CTGGGACTGCAGGTGCGTGCCACCACACCCAGCTAGTTTTTAAATTTTTTTGTAGAGAC
GGTGTTTCCCTATGTTGCCCAGGCTGGTCTCGAACTCCTGGACTCAAGCAGTCCTCTCAC
CTCTACTTCCCAAAGTGCTGGGATTACAGGTTTGAGCCACTGCACGGGTGGCCCAGAGTA
TATTATTATTTTCGATGGACAGATCTTAATTGTATACATCATGGGATAGGGGATCATTCA
TTTTTATACCAAGATATGTTTGATTATTTTGTGAATGAAGCTTAGAGAGGTTAAGTAATT
GGCTCAGAGTTCCCTAATGAGTAGCCAGAAGACTGTTTTTGTTTTGTTTTGTTTTGTTTT
GAGATGGAGCCTCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGCTATCTCGGCTCACTG
CAACCTCCGCCTCCTGGGTTCACGCCATTCTACCTCAGCCTCCTGAGAAGCTGGGACTAC
AGGCGCCCGCCACCATGCCCGGCTAATTTTTTTTTTTGTATTTTTAGTAGACACGGGGTT
TCACTGTGTTAGACAGGATGGTCTCTATCTCCTGACCTTGTGATCTGCCCGCCTCAGCCT
CCCAAAGTGCTGGGATTACAGTCGTGAGCCACTGCACCTGGCCTCATAAATCTGTTCTTC
TGGCATCTAAAGCCCAAGCACTTATCACTTCCCATTGGGTTATGAAAGTAACATACTCAG
TTTTAGTATGGGTGACTGAAGACTAATGTTACTTGTTTATTGTTCAATGAATTGAGTGTA
TACTAGGCCTCCAGGTGTACTGTATCGCTGTGTATTGGTAGATCTGGTCCTTACTCTCAA
GAAATGTGTAATCTGGTAGAGAAGATACACATTGAACAAGTATCACAAATGTGTTATGTG
CTGTGGAGAAAAAGAATGCTGTCGGGGCATGATTGAGGGCAACCTAATTTATTTGGGGGG
TATGATAACACTTTTCAGGAAGTGATGTTAAACTTTGCCCACTGTGATGATGGCATTTCT
TAGCACAATTTTGGATTAATTATGAAAACAACTACTCTCTGAGCAATTGTTGAAAAAAAA
CTTAAAAAGCAAACTTGGCCCAGAAGATTAGGCTTTAGTTAGTTTGAAGGCACTGAGTAA
GAGTGTGGTGTCAGGTAAAGGGATGAAGAAGCATTCAGGTAGAAGAAACTGCATGTACTA
AGGTTCCTAAGCTGAGAGGAATGGAATTGGAAAAAACAGAATGCAAAACTCAACAGAAAT
AGAATGTCTGGGCTGTACAAGTTAGTAGAGAAGAGGCAAGAGTTTTGGTGTTAGGATGAG
GTTGAATCTTGGCTCTGTTTCTTACTATTTATGTACATTTAGACAAGTTATTTAACCTTA
ATGAATTGGTTTTGTCATCCTTAAAAGGGAAGGTAGCATTTAACAAAATATTTGCTCAAT
AAATAGCATCTCTTATTATCATTAATAGCTAGTAATTGAAGTTATAGCAGTGCAGATGAC
ATGCTTTCATTCATTCATTCTTCGGAAATAATGAGTGTCTTTTGTTAAGCCAGGCAGCTC
GATATACAATAGTTGAATTACACACGTATATGTATTATTACATGAAAGTGTTATAAAACC
ATATACTTTTACTATGCAAAGCACTGTGCTAAAATTTTTTTCTATTCTATTTTCCATTTG
AAGAAAGGTTCAAGAAACTGGTCTGAAGCAATCTACAGTTTGAAAATTACTGATACGGTG
AAGAGATGATGATTACTTAGCCCCTTATTAGAGATATGATATGCAAATATTTTCTCCCAT
TCTGTAGGCTGCCTTTTCACTCCACTGATTGTGTCCTTTCATGCACAAAAGCTTTTAAAT
TTGATGTAGTCCTATTTGTCTGTTTTTGCTTTTGTTTGCCTGTGCTTTTGGCATTATCCA
GGAGTTCACTGCCAAGTCCAGTATCATTAAGCTTTCCCCTACGTTTTCTTCTAGGAGTTT
TATAGTTTTATGTTTTACATTTAGGTCTTTACTTCATTTTAAGTTAATTTTTACATGTAG
TATAAGACCAGGGTCCAACTTCATTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved