Pongo_pygmaeus Locus Mono:52:SNORD77
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:52:SNORD77
Pongo_pygmaeus
Mono:52:SNORD77
X
SNORD77
1001..1068
2068
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCAGGTCTCTTAAGC
CCCTGCCCACGGGAAATAAGCAAGTGGAAATTAAGGCTCATATACAGCCACCAATCAAGC
CAAGGTAGATCAGGACCTGCATCCTAACTCCCTGTCTCCATGATAAGACCATAAAAGTGT
TCATCCTCCTCTTTCCTCTTCCACATACGGTCTCTTGTTGCTCGTTTCCTTCATACTCAT
CTTTCTCTAATTATAGCCTTTATTTGTGTTTATATACCCAATTTCACCCATGTTAGTTCA
TGGTGTTTTCAAAAAAATCATTAAGACAGAATCAGAAATAATAATATCTAACATTTACTG
AGCACTTAAATTGTGTATGAAGCACTATAGCAAGCAATTTGCATACATTATTGTCTTAGT
CAGTTTGGGGTGTATAACAAAGTACCATAGACTGGGTAGCTTATAAACAACAGAAATTTA
CTTCTCACAGTGCTGGAGGTTGAAATAGATCAGGCGTGGGTTCTGGGGAGGGTCCTCCTC
CTGGTTGCAGACTACCGATTTCTCCTTGTAGCTTCACATGGCAGAAAGAGAACTAGAGAG
CTCTTTGGGGACTCTTTTCTAAGGGCACTAATCCCTTTCACGAGGACTTCATCCTCAGGA
CCTAATCCCCTCCCAAAGGCTCATCTCCTCATACCATCACAATGAAGGTTAGGATTTCAA
CATCTGAATTTTGGGGGGACATAAACATTTAGTCCATGACACTTAACTCATTTAAGTCTC
ATAACAATCCTTTTGGAATAGTGTCCCTATTTTACAGTTGAGAAAAAAATAGTTTGAGAA
GGTGGTTGCTGAGGGCTGGAGATAGGAGGGAATGAGAAATTATTGTTTAATGTGTATCAA
GTTTCAGTTTGGGTAAATGAAAAGAGTTCTGGGGATTCATTGCGCAACCACGTGAACACA
CTAAACACTACTGAACTGTACGCTTAAAAATGGTTAAAAGGGTACTATGACAGTTGCATA
GTTCAGCAGATTGAATCATCAAGAGATTTAATATTTGTCTGGTGTATCTGGGACAATTTT
TTTTAATGGTGAAAAAGGTAAATGCTATGTTATCTGTATTTTACCACAATTTTTTTTTTT
GTTGGTTTTTTGAGACAGAGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAATGGTGCGAT
CTCAGCTCACCGCAACCTCTGCTTCCCGGATTCAAGCAATTCTCCTGCCTCGGCCTCCTG
AGTAGCTGGGATTACAGGCATGTGCCACCACGCCTGGCTACTTTTGTATTTTTATTAGAG
ATGGGGTTTCTCCATGTTGGTCAGGCTGGTCCTGAACTCCCGACCTCAGGTGATCTGCCT
GCCTTGGCCTCCCAAAGTGCTGAGATTACAGGCGTGAGCCACCATGCCCAACCTTACCAC
AATTTTTAAAATAAATAAATATTACAAGTTAAAAAGGCTGGAAGCATCTAAACCAAAATG
GAAGCAATGATTATATTTAGAGACTACAAATGGAACAGTTGTTATATTTAGAGGTACTAT
TGGGGTGCATCTTATCTGGTGCACTTTTCTCTATTTACAAATTTACACAAATTTACAATA
ATAAACATAAAAATAGTTGAGAGGGGGTGAAAGGGTTGATACTGTGTGAAATGCCCCACA
GGGGACACCAACATGTCCATTTCTGGAGCTATCTTCTCATTTGTTTCCCAGCTCCTGCTG
TACCCTCCACATCACTCTGTTCACAACCAGCCATCTGGGTAGGTTGACTGGCTTTCTAAT
GATTGTTAGTCTACAGTAGCCCAGAAGAAATAAAGTTGTTGTGGTTACTTTTAGCAATCT
ATAAACCCATTTAACAATCCAACTTACGTAATCTCATCATGTCCAGGAGCTAAGGCCCAC
GGTTCTGGGCTTTTTTGTCCCCACTTTGCTCAGGGCCCTACAACTGTGCCCCCACAAACA
ATCAAATAATATACTTTGGCCAGGTCCACAAATATGTATTGTGAAATGCCTACACACAAA
ACAGGAACCAAGAGTGTTTCCTGAGGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved