Pongo_pygmaeus Locus Mono:101:SNORD55
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:101:SNORD55
Pongo_pygmaeus
Mono:101:SNORD55
10
SNORD55
1001..1080
2080
GTTAAAAACACATTAATAGGTCTTTTGTGTAATAAAATTGTAATGTAACTATGTCTCAG
AACTTATTTAAGAGGAAATGTCTAGAAAAGCCTCAAAACAATAAGGAGACAAAAACAGTA
TAACAGAGAAAATTTTTGCATTTGACATCTACAGCTATAGCAAACAATAAACACAATCTA
AGCACTAGCCATATAAACATAAAGCCTCACACTAAATGCCTACTTAGTTCAGTTTATTTT
ACCCAATACATCATATCTTGCTTTCAAAAAATTACAAGACATACTAAAAGACAAAAAAGA
CAGTTTGAAGAGACTGAGCAAGCATTGAAACAAGACTGAGATGTGGTAGAGGTATTCAAA
TTCAAATTAGAATTTAAAATTCAAATTCAAATTAGAATTTAAAATTCAAATTCAAATTAT
TGAACAAGTAATTTAAAATAACTATAATTAGGGCCAGGTGCAGTGGCTCATGCCTGTAAT
TCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGATCAGC
CTGGCCAACATAGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCTGGGCATGGT
GATGGGCACCTGTGATCTCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCCA
GAGGGTGAAGGTGGCAGTGAGCTGAGATCATGCCATTGCACTTCAGGCTGGCAACAAGAG
CGGAACTCCATCAAAATAAAAAAAAACTACAATTAATATGATAGGCATTCTACTGAAAAA
AGCAGGCAATATTCAAGAATAGATGGGTAATGTAAGCAGAGAGATGGAAACTCAATATTG
TTAAAATATCAGGAAGAATGAAAAAGAAATACTAGAAATAAAAAAGACTTTAACAGAAAT
AAAAAATACCTTCGATGGGCTCATTAGTACACTGAACACAGCTGAGAAAAAAAAATCCGT
GAGCTTGGAGAAGTTAATCAAAACCTCCAAAATTGAAATGCAGTGTATGATGACACCTTG
GTAATGCTGCAGACTCCTGAGTGTGCAGTGAAGAGGTGAACTTTGAAGAGTCACATATGT
GAAAAAAAAAATGCACAGAGCAAAAAATGAAAAATACAGAACAGAATATCTAAGAACTGT
AAAACAATTACAAAAGGTGTAACATATATAATAAGACTACCAGAAGATGAAGACAAAGAG
AAACAGAACCCAATAAGATATTTGAAATAATATTGATTGAGAATTTCTCAAAGTTAACAC
CTCCAAACAACAGGCACCAAAAAAAATCAACCCGGCCGGGCGCAGTGGCTCACACCTGTA
ATCCCAGCACTTTGGGAGGCCGAGGCAGGCGAATCACAAGGTCAGGAAATCAAGACCATC
CTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAATACAAAAAATTAGCCGGGCAAGGT
GGCAGGCACCTGTAGTCCCAGCTACTCGGGAAGCTGAGGCAGGAGAATGGCATGAATCCT
GAGGAGTGGAGCCTGCAGTGAGCCGAGATCACACCACTGCACTCTAGCCTGGGCGTCAGA
GCGAGACTCCGTCTCAAAAAAAAAAAAAAATTCAACACTTATGCATATCATGTTCAAATC
TCAAAAAATCAATGACAAAGAAAACTGAAAGAAACCAGAGCAGATGGGAAACACCTTCCC
TGTAGAAAAGCAAAGATTAGAATTACATCAGACTTCTCTTCAGAAGCCATGAAACAAAAA
GAGAGTAGAATGAAAATATTTAATGTGTTGAAGAGTAAAAATAGTCAACCTAGAAAATTT
TTTATCTGTGAAATTATGCTTCAAAAGTGAAGAAAAATTGAGGACTTAGTCAGATAAAAC
TAAGGGAATTTGTTGCCAGTAAACCTACCTTACAATAAATGTTAAAAGAAGTTCTTCGGA
AAGAAGGAAAATGCAATGGGTTAGAAATTTGAATCACATGATAAATGTGGATCATAAATA
AATACATTCTATTTTTATTATTCATGATTTACCCATACAGCTATTTAAACATATAGCTAT
TTGTTTAAAATAATAAGTAGCAACAATATATTCAGTGATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved