Pongo_pygmaeus Locus Poly:19:SNORD27
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:19:SNORD27
Pongo_pygmaeus
Poly:19:SNORD27
11
SNORD28, SNORD29, SNORD30, SNORD31, SNORD25, SNORD26, SNORD27, SNORD28, SNORD30, SNORD31, SNORD22
1394..1468, 2112..2176, 2348..2417, 2685..2755, 3731..3799, 3997..4073, 4284..4356, 4677..4751, 5823..5892, 6137..6207, 6497..6622
7622
CAGGAGGCTGAGGCAGGAGAATTGCTTGAACCCGGGTGGTGGCTTGCAGTGAGCTGAGA
TCGGGCCATTGCACTCCAGCCTGGGCAACAAGAGCGAAACTCCATCTCAAAAAAAAAAAG
AAAAAAAATGTTTATGAATTGTGCTTGTATACGTAGATGTTTACAACAAACGACTGAACT
AATGCTGTCCGGTCTCGGTAAAACAGTCTATAGCTGACTGCAACCATATTGATCAGGCAG
GAGTTGCAGCAGGCAGCACCGCCGGAGCTCTTTAGGATTCCCCATCAATAAAATGGAGGT
TGTCATCCTACCTAGCTCTTGGGATTTTGGTGGGTTAATCGATTCATATAGTGCGCTTAA
AACGGTGCTCCATAAATGTTAGCTAATGTTGGCCCGTAGTAGTCCAAGATCTAAAGAAAA
CGCACCAGAAGACAGGACATAGGTGACCAGTTAGGAAAAAATCAGATCCTGTCTTCAGTG
GAGCACTTACGCCCTGACTTACTTTCCCGAAATGGCCCCACCAAAGGGGACCTCCTCCCG
AGCTTAGCCCGGGATCCAGTACCTGAGTCGTCCCCCGCGCTGAGACCCTGGACACCAGCC
TCCGAATGTGAGCCAGGCAGCTGGCGCGGAATCGACACGACGGCGATCGAGGCTTCAGGA
GGCTGTAGCTCCATGGAGGCAGATCCTGCACACAGGTTTGGGGTGTGTGGGGGCAAGGGG
CAGCTCAGAACAGTGTTAGAGGGTAGGCAGTCGTGACCGTCAGTCCAGGATCGGCGTGAG
GCAGTGATCTCACCGCTCCTGCCACATGCACTGGGTGAGAAAACCAAGCCGCAATGCGGT
CGGTGAGCCAGCACGCTTCCGTAGGACGCATGCGCGCCTTTTTTCGCGCCGCAAGTTCAG
TAGCGCTTTGTCTACGCCCCTCCTTCCTGAACTCTCTACCCACAACTCCCGGGTCGCATG
CGTCACGTGTGCCGTGGCCTCGCGTAGCCCGCCCCNNNNNNNNNNCATGATGAACACAAA
ATGACAAGCATATGGCTGAACTTATCAAGTGATGTCATCTTACTACTGAGAAGTGAGAGA
GAGGTCTTAAGGGGTCTTTGAATGACTATTTTTAGGTACATAAAATGACTTCCTCTGTTT
TCTACAGCATCTCATAATCTATCCTGAGGAATTCAGCTGCCTCCCAGGGTGAATACAGGT
AATTATCCAAATTGGTGTATGTCATCTCTAAATGTTCACAAGAAAACAAGTGGCCGGCGG
AAGCAATATTGTTTTTTGGCGCCTTCCATCTTGTTCCTCTTGAAATGATTTTCTGGGGAG
GGAGATCGCAACCCGGTACTACAGTTCTTGTAAGGGTGTGCTGTTACCCTCATCCATATA
TCGATCACGTTACTGTCAGATGATTTGAATTGATAAGCTGATGTTCTGTGAGGTACAAAA
GTTAATAGCATGTTAGAGTTCTGATGGCAGTTGTTGTTTATGAATAAGCTTCATTCCATC
CTAATACCTTAAAATAACTAATTTGCTTTCCTTTCCAGGTATTTCTGATGACAGTCTGCC
TCTATCTTACAGTAAGTTGTTTTTCGAATTCTATGGGCCTATTATCTAATAGATATAGCC
ATCTTGATATTTGTTACATTTGTTACCAAAGCCTGCTTAACCCATAAAGTTTTCTGGTTC
CTCTTGTTCTCTGTAGTGATGTTTCTAGACCTCCCCTTTTTTCTCTCAGATAGATGCCCA
CTGATCTGCCCGGGGTCAGACGAATGCTTGTCAGTTGTAGTTTTCCAGGATTCAGCTCCA
ATGAGAAGGAAACATGCTACCTTACCCCTGTTCTAGCCTGGGAACCAGTAATTGTGAACT
CACCAGGGTTAATTTGAAGAGGGCATGAGAGCTTATTCCATAAGGAACTGTCTGAGGCAT
TTGGTTACCTTTCCTTAGCTTGTCCATTAGCAACTGTAACTAAAATAGTTTGGGCTATTT
GGCATAATTAGCTAATTGAATGATTTTTTGATTCAGGAGCAGCTTGTTGCTATATACCAT
TGAAAAGCCTTCAGAGCTAAGAGGTTAGTTGATATTTTTTGTTCCTTACAGCTCATGCCA
CCAAGTAGGCAGTTTCTATGATGAATCAAACTAGCTCACTATGACTGACAGTGAAAATAC
ATGAACACCTGAGAAACTGGAGAACGCAGGGAGTGGGGGGTAACCATGTCTGAGGAATCT
TTCACCCACAGCTTTGTTTTTCTCTAGGTACTACTAACCAATAACCTGCTTGGCTCAAAG
GTGAGTAATTTCACTGTATTCAATGCATTCAGCATATAGGGTAGGAAAAAGTGCCTTTTT
AGGTCTGTGTTTGTGATGACTTACATGGAATCTCGTTCGGCTGATGACTTGCTGTTGAGA
CTCTGAAATCTGATTTTCTAAGAATGATGGGTGGGAACAACATAATGCAGGATATGAGAA
GCACTACTGACTTGGTCTTCCTCCTTTCAGGGCCAGCACCTTCTCTCTAAAGCCCAAGAG
GAGTTTGAGGTAAATGGCTTTGCAATAGTTACCGTCAATAACTGCTATATAAAATTTTCT
GTGATTTTTGTGTGTGATAGCACTGTGGTCTGGGTGAATGTATACAGACATAACTGGCTT
AACCCAAAGTCTTTGATCTCCTGAACCACCAGTGATGAATTGCTGCTCACCAGTGATGAG
TTGAATACCGCCCCAGTCTGATCAATGTGTGACTGAAAGGTATTTTCTGAGCTGTGAGCC
TGCCTTCCAGCGACATGTTCTAAAAATTGCAAGTTATTTGAGGAGGCTTTACAGCCAATA
GGAAGTTCTTGGGCTAAGTAGCATTTCCTATAAAATGTGCCCTGAAACTTCTTTCTGCCA
AGCAACAGATATAATTGAGAGATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGGACACCACCCTCCGAATGTGAGCCAGGCAGCTGGCGCGGAATCGACACGACGG
CGATCGAGGCTTCAGGAGGCTGTAGCTCCATGGAGGCAGATCCTGCACACAGGTTTGGAG
TGTGTGGGGGCAAGGGGCAGCTCAGAACAGTGTTAGAGGGTAGGCAGTCGTGACCGTCAG
TCCAGGATCGGCGTGAGGCAGTGATCTCACCGCTCCTGCCACATGCACTGGGTGAGAAAA
CCAAGCCGCAATGCGGTCGGTGAGCCAGCACGCTTCCGTAGGACGCATGCGCGCCTTTTT
CGCGCCGCAAGTTCAGGTAGCGCTTTGTCTACGCCCTCCTTCCCTGGAACTCTCTACCCA
CAACTCCCCGGGGTCGCATGCGGTCAACGTGTGCGCGTGCGCTCGCCGTAGCCCCGCCCC
CAAATCCCGTGGGCCTCTGCGGGATGCTATTTAATCGTCTCTTTGTGCCAAATTCGTTCT
CATTTTTCTACTGCTCTTGGTAAGTGACTCTGTGGGCTTTATAGCTGTTACTCTTTTGTG
GTTTGTCTTTTTCTTTTATTTTCTTTTGAGCGATTGTGCGAACATAGCATAGCACGCACT
ATGCCTTCTGTGTTGTAGCTGTCTGGCCAGGGTGACTGGCGGATAAGGTCTTGTGCGTGG
CCTCGAGGCTTAAAAGTAGCAGCGGTGCTTTGTGAAGGACAAAATGGCGATGGCGGGCCG
TGCAGGTCCCCCTTCCTATGATGAGGACCTTTTCACAGACCTGTACTGAGCTCCGTGAGG
ATAAGTACCTCTGAGGAGATGGGTCCTGCAAGCCTCCTGCTTAGCTGTCTGTTCAGAAAA
TAGCGTTTTCGAAATAACCTGTGTTGACCTAATGTCTTATTTGGCTCCTGTCTGCAGGGT
TTACGCGCACGTTGGAATCGAAGAGAGCTCTGTTGTTGCAGTAAGTTCTTACGGCCATTT
CTTAATCTCTGCTCTTTCGTTGAGTGTGTGGAAGTTGCTACGGGGATGATTTTACGAACT
GAACTCTCTCTTTCTGATGGATTAGTGGAGAAAACACAAAAAATTCTGAGTAGCACTGTA
CTGTACGCAACAAATGTCAGGGCCCTATTGATTTGTCTGAGGTGTTAGTGAAGGGTGTTA
TTTTTTTCAGATGTTCAGCCCACAAGAGCTTACAGGTGAAGGAATGGGACAAGACCCATC
TTTATGCAAAGCCAGCGTTACAGTAATGTTCCAGGTAGGTGTACATGGTTTATGCACTTA
TAGAGGAGACCTTGCTAGATAACCACTCCATGATGAACACAAAATGACAAGCATATGGCT
GAACTTATCAAGTGATGTCATCTTACTACTGAGAAGTGAGAGAGAGGTCTTAAGGGGTCT
TTGAATGACTATTTTTAGGTACATAAAATGACTTCCTCTGTTTTCTACAGCATCTCATAA
TCTATCCTGAGGAATTCAGCTGCCTCCCAGGGTGAATACAGGTAATTATCCAAATTGGTG
TATGTCATCTCTAAATGTTCACAAGAAAACAAGTGGCCGGCGGAAGCAATATTGTTTTTT
GGCGCCTTCCATCTTGTTCCTCTTGAAATGATTTTCTGGGGAGGGAGATCGCAACCCGGT
ACTACAGTTCTTGTAAGGGTGTGCTGTTACCCTCATCCATATATCGATCACGTTACTGTC
AGATGATTTGAATTGATAAGCTGATGTTCTGTGAGGTACAAAAGTTAATAGCATGTTAGA
GTTCTGATGGCAGTTGTTGTTTATGAATAAGCTTCATTCCATCCTAATACCTTAAAATAA
CTAATTTGCTTTCCTTTCCAGGTATTTCTGATGACAGTCTGCCTCTATCTTACAGTAAGT
TGTTTTTCGAATTCTATGGGCCTATTATCTAATAGATAAGTTACCAAAGCCTGCTTAACC
CATAAAGTTTTCTGGTTCCTCTTGTTCTCTGTAGTGATGTTTCTAGACCTCCCCTTTTTT
CTCTCAGATAGATGCCCTCTAATGGTGCCCGGGGTCAGACGAATGCTTGTCAGTTGTAGT
TTTCCAGGATTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTTTTCTCTAGGTACTACTAACCCAATAACTGCTTGCTCAAAGTGA
GTAATTCACTGTATTCAATGCATTCAGCATATAGGGTAGGAAAAAGTGCCTTTTTAGGTC
TGTGTTTGTGATGACTTACATGGAATCTCGTTCGGCTGATGACTTGCTGTTGAGACTCTG
AAATCTGATTTTCTAAGAATGATGGGTGGGAACAACATAATGCAGGATATGAGAAGCACT
ACTGACTTGGTCTTCCTCCTTTCAGGGCCAGCACCTTCTCTCTAAAGCCCAAGAGGAGTT
TGAGGTAAATGGCTTTGCAATAGTTACCGTCAATAACTGCTATATAAAATTTTCTGTGAT
TTTTGTGTGTGATAGCACTGTGGTCTGGGTGAATGTATACAGACATAACTGGCTTAACCC
AAAGTCTTTGATCTCTGCTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGATCAATGT
GTGACTGAAAGGTATTTTCTGAGCTGTGAGCCTGCCTTCCAGCGACATGTTCTAAAAATT
GCAAGTTATTTGAGGAGGCTTTACAGCCAATAGGAAGTTCTTGGGCTAAGTAGCATTTCC
TATAAAATGTGCCCTGAAACTTCTTTCTGCCAAGCAACAGATATAATTGAGAGATTGTAA
AATGTGTTGTAGAATGAAAGTCTCTCAAGACTACATTTTTTTTTGTTGATTTTGCAGGAA
AACTAGGTGTCTCTGTTCACTCCAGGCTGAAGTTACAGGTGAGTAAACCTAAATGTAAGG
TGGACTATGCTAAAAATTCCCAATGAAGAAACTTTCACATGTCTTACTCTCTGTCCTAGT
CCCAGAGCCTGTAAAGGTGAACCCACTGGGACTGGCTGGGGGAGAAGAGGAAGATTTGTT
CCAGAAGGAACTGTCTGAGGGATGATAAAGATTTCTATACAGAGAAAGGGAGTAATCATC
ACTTGTTGAAAACATTGGTTTTATTTTTTCCAGGTCTGAGGAAAGGTGTATAAAAAATGG
TAGGTATCTGTTTAAATATTTAACTGGTTTTATAATAGCAACCTTTTGCTTCTAGGTTAC
ATAGTGTTAAATATTGTGTACATTTGTATTTTCCAATCCAATAAGAACTTTTTTTTTTCC
TCTGCAGGAATCTGTCTTGGAGGACATCAGAAGTTGAATTTTCCAAGTCCTTGGACAACC
TAGCTGTTGAAAAGCTTTCTGGATTTGGGGGGTCTTTCAGATGTACCTTAAAGTGTTAGC
AGACACAGATTAAGACACTGGGAGCCAATGAAACATAGCAGTTGAGGGTTTGCTATGTAT
CACATTTCTGTATTTTATCACCCCCTTCCTGCAACATTATTTCTGTGGAATCTACCTGCC
CTTTTGTTTTTTAGATACAAGGGCTTGGTTTTGTTACCAAGGCTGGTTTCAAGGCCCTAG
CTTTAAGAGATCCTCCCACCACAGATTTCCAAAGTGCTGGGATTGCAGGTATGATTAGTG
GCACCCAGACTTTGCTGCCTTTCTTACATGATCAAGGCCCAGAACCCAAACTCAGGCACT
GCATAGATGACCAGTTTGGTAAACTACTGACCTAGCTTGTTGCCAATTGTGATTGAGCTT
CCCATAACTCCACTTCGTTTCTGTTTCTCTGTATACAGCCACCTTCTATTCCCATCATGA
GCCTTTAGGTCTCCATTTGCATATTGCAAATACTATGTTCCGTGTAGGTAGCTCATTCAG
TGCCTTGCTCTTCACTTCAAAAAAGGTTCCCTTGAGGACTGGCTGTCAATTTGTGTTGCT
GTGTTGGTTAATGAAAATAATAAAATGATTGATTACATAGTCCTGTTTACTTTTTTTGTG
TGTATGTGTCTCTTAGCATCAGTGTGTAAATTTCCATGGGAAACTGGCTTTCCTCTCATG
CAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved