Pongo_pygmaeus Locus Mono:117:SNORD42
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:117:SNORD42
Pongo_pygmaeus
Mono:117:SNORD42
4
SNORD42
1001..1065
2065
TTTCTAAAAGAGAGATCATTTAGTTTAATGAAAGACTCCCTCCCTCCCCAAACATCCTT
CATTTCCATTCTTAGGGGTTTAATAAATATTGGCTGCTTTATTCTATGAGTTGGCAAAAT
TGTCAAGGGCCCAAGTTACTGTTTCAACCAGGTGTAACAACTTGTGTGTGTGCATGTGTA
TCCTGAAATGGGTTTTTCTATATCTAAACTTTTCCCCTCTCCTTAGAGCAGAAAGATTAT
TAGCTTTTCTCCAATAATTGTATATGTATCTATAGCTGGCTCCTGCTTTTTCTTTTCTTT
TCTTTCTTTTTTTTAAAGAGACAGAGTTGCACTATGTTACCCAGGCTGGAGTGCAGTGGC
TATCCACAGGCGTGATTACAGTACACTACAGCTGCGAACCCCTGGCCTTAAGTGATCCTC
CTGCTTCAGCCTCCTGAGTAGCTGGGACTATAGGTGCATGCCACTGTATCTGGATTCTTC
TCACTTTGTTTTCCTGTTTTCTCCCTCCTATCCTCCCTCAAGAAATTTTAAAGGTGAATT
GACTTAAAAAAAATCATTTTGTTGTCACGTGTGCATGCTAGAAATATCTAGTCCACATAA
ATAATCAAAAATTTCTAAACAGAAAAAGTTAAAAATGGTATTTTGTTATGTAAAAATGCT
AACACTGTATTTTAATTTTCATAATACTGAAGTTAAATTTCTAATGCTTTAAACTTTCTA
AATTTTTATATTGGGCTTAAGAATCAAATAACTTATTATTTCCAAAAATTGTTCAAGATT
GAAATATAATATGGTGTTTAATTAAATAAAAATGTAATTACAGATGTCTTTTGAAAGGTT
TTGATTATGTGAAATTCCTATAATACTATAAAATGTGTTAATTAAAATTTTAATTTCCAA
GTTTTAAAATTTTTAAGAACTTATAAAACAAATTAATTGATATATGATCTTTGGATACTT
GAACAATTTTAAGTTAAAAAATGGTACAAAACTCTGGTCATAGCATATGATGGAAAAACC
TTAATCTTCTGAGACTTGTGATGTCTTCAAAGGAACCACTGATGCACATGTGGAAATTTT
ATAATTTAAAGAAAAAGAAAAGTAAAAAAAAGCCCTCCCCAAGATGGCTGCTGAAGATGA
ACTACTGCTCCCGCTGTCCCCCCGAGCTGTTGGAAACCGGCAAACAGATTCTGGACGAAG
TAGAAGTAGGGACTGAATCCGCCGGTTTCCGGATAGTCCAGGAGAAGGTGTTCAAGGGCC
TGGGTGGACCTCCTTGAGAAGGCTGCCGAAATGTTATCGCAGCTCGAGTTGTTCAGCCGA
AATGAAGATTTGGAAGAGATTGCTTCCACCGACCTGAAGTACCTGTTGGTGCCAGCGTTT
CAAGGAGCCCTCACCATGAAACAAGTCAACCCCAGCAAGCGTCTAGATCATTTGCAGCGG
GCTCGAGACCACTTTATAAACCACTTAACTCAGTGTCATTGCTATCATGTGGCAGAGTTT
GAGCTGCCCAAAGCCAAGAACAACTCAGCCGAAAATCACACCGCTAATTCCTCCATGGCT
TATCCTAGGCTTGTTGCTATGACATCTCGAAGACAGGGTAAAATAGAGAGAGACAAGCAG
AAGAAGGAGTTGGAGCATAGGTTGTCTGCAATGAAATCTGCTGTGGAAAGTGGTCAAGCA
GATGATGAGCGTGTTTGTGAATATTATCTTCTTCACCTTCAGCGGCGGATTGATATCAGC
TTAGAAGAGATTGAGAGCCCTGACCAGGAAATAAAGATCCCAAGAGAAAGAGACTCTTCA
GGAGGCATCAACTTCTAACTCATCTCACCAGGAGAGGCCTCCAGTGAAACCCTTCATTCT
CACTCAGAACACGGCCCAAGCCAAAGTATTTGGAGCAGGTTATCCAAGTCTGGCAACTAT
GACGGTGAGTGACTGGTATGAGCAACATCGGAAATATGGAGCATTACCAGATCAGGAAAT
AGCCAAGGCAACACCAGAGGAATTCAGAAAAGCAGCTCAGCAATAGGAACATCAAGAAGA
AAAGGAGGAAGAGGATGATGGACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved