Pongo_pygmaeus Locus Mono:39:SNORA25
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:39:SNORA25
Pongo_pygmaeus
Mono:39:SNORA25
1
SNORA25
1001..1124
2124
CTCTTAAAGAGCAAAAAGCTAAGAATGGGAAGCAAGACTCGTGTGAATCCAGATCTGTA
TGGACTGGTTTATTCCTATCCCAAATACCTGCACTTGTGTAGCCTCTGATTACAGGGGCT
TAAGCTTGTGAGTTCAGTGCCAGCAGACAACTTTCTCATTCTTTAGAAGGCCATTCCAAC
AAAAAGTGGGCTAGCTGCCTCTGGAAACATTTAGGTCCAGTTTTGCTAGGAAGCAAACAA
TCATGTGGAGGCTGTTTCTAGTGCAGGGTAGGGAAGAAGGGGGTTGGGGTGTGGGGTTGG
GGAGGAGACTGTCCCCATCGCATGCTTTGGGAATCTTCCCTCTTGCTGCCAACTGTACAG
TGACTCTGAAAAGCAGCTGAAAGAGGAGGAGGAGGAGGCTCTGTTCACACATGAAAGGCT
AAGAGTCACTTAGGTTATAACACATACTCACCCATAATTATCCCATATTCCTCTAAATTA
TCCACACCATGATGGACAGTTCCCCCCTTCCCCCCACAATTTTCCCTAAAGTTGTGGACC
TCTGATGACCTCGAAACTGATCTAACATAGTAATTTTGTTCTGGGTTACCTGGCCCACTC
CATCTCCTTCTGTGATCTGTCTTGGATTGTAAGCCCTACTGAAGGGACCAGCTGGACTGC
CTTATGTGTTCTATGTGACCATCCAGCTACAGCTGGTTGGACCAGAATCAGATCCTGTCT
CAATGTCGAACAATCTATTGGCTGGTCAGCAGCCAATCAGATTCACCCTCTTGAGAATTT
CAAGTATGTGCTGCACAGCCAGAATGCAATCAGAGCTCAAAGGTTACTGAGAGTTGGGAA
CTTTACCTACAATCAATGCTGTAAACAGGCTGAAGTTATTAAGAGGCAGAGATACTTCTT
GAACAAGCTGCAGAGAGAAAAATGGCCCAAATGTATAAACAGATGAGACCATAGAGACAC
CATAGAGGCCCCAGAGAAAGAGAATCAAAGAGAGGGACTATAAGTCATTTCAAAGAGGGC
TTGGATGGCTGTGAAACCAGAGCTCTTAAGGTTATAATAAGATTGAAATTTTCCAAAGGA
TGCTGTAGTCACACAATAGTGCTGTTTTCTTGAGGAGACAGAAGACTTAGCCACTCATAA
TCATGACATTTCATTCATAATAATCCATGATTTGAGATGTGGGAAAGTGAATAGGTATCT
CACGGTTTAAAAAGGGAGAGAGAAGAAAAGAGGAAAAGAGGGGGTGGGGAGAGGGAGAGA
AAGAGAGAGAGAGAGAGAGGATACCTTGAGCCCTAACAGTTCAGATTTCCCAGATTCAAT
TTTCAAAAGGAGACTGGCTGCACTTTATTTCCATGAGCTGTCTTAGAACCTTACAATGAC
TACCTCATTCATTTTGGTTTGCTTTTCTGTCCTTTGCATGCAGTAAATTCATCCTAAAAT
TCATTTATCTTCATGTAATCTGATTTCCTTGTATTATAAAAATGCTCACTCCCAAGTCTC
CAAGGGATAGTCCTGGAGTTGGTTGTGGTGTCTATCTAAATCTCCACAGTTCCCCTGACA
ATTGGCCTTGGCAGAATGAAAGACCATTAAGAAGCTGAGCAAGGAGAGGAAGGAGGAAAG
CTTCACCTCTGTAACTGCCTATAATGTTTCCTGGAGAAAAATGAGCCCAGGAGCTGAAAG
AGGGCATCTAGTTAGAGCTACAGAGTGCCTTTCATTGACCTGGTGTGGTCCCTAGAGAGA
AAGTGCTGTGTGTTTCCTCAACTGGTTCCTTTACTCATTTATTGTACATAGATATGGGCC
TGACCCTGGGCTTGGTGCTAAGGAAGCAGATAAATACAACACTGAACCTTCACTAAATCA
TGAGTTTCTTCTCACGGTTTAGTGGAGACACTTTGGCATTCTATTCGTACTGCAACAAAA
CAGTCTGCCTTCTATGAGAGTTATTTATCTCTGTGTCAGTCTCTTCTTTGAGACGAAGAG
TCTGGAAAGAACAGGGACCCTGGGTTATCATCTCTCCTTCCCTCCGCTGAAACTAATGCC
GAGCCTGGCGCTCAAAAACTGACTGGATAATTGGTTACCAGGTTTGGGCTGTGGATTTGA
ACTGTGTTGCTCCTCCCTGCCCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved