Pongo_pygmaeus Locus Mono:43:SNORA2
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:43:SNORA2
Pongo_pygmaeus
Mono:43:SNORA2
1
SNORA2
1001..1137
2137
GCTTATTCAGCTTTTTACTTGTTGTTAGGGCTGAGTGACAACTTCCAAGCTTCTTACAT
GCCAGACTGGAACTGGAAGTTGGTGTGTTACTTTTTTAAAGTATAAATTCTGGGCCTTAC
CCCAGACCTACTGATTCAGTCTCAAGGGGTAGAGCCCAGGATCTTTATCTTAAGAAATCC
TCACCAGTGGGCACCCATGTATTATGGCTTCTGAAGCATAATTTTATAAGAATGAAACAT
AACTCTGGAAACTCCTGTGAGAAGAGTAGCCTTGGCCCCAGAAACAAGGTAGAAGGGTTC
CTAAGCTGTTCATTATTGAGAGAGACACCCAATCAGGGATTTATAGTTTGGTAGCTCTTC
ATCTACTCCCAAAGGTGCATCCAATAAAATGAAGGCCCAGCACCAATATCCCAAGACCAG
GCACAGGCAAGAGGAGATGGACACCAAGGTGCTGCCCTAGGTTCAAGGATGTGGTTGTTT
TCCTCACCCAGGAGGAGGACCTGCATCAGAGCAGTGGGAAACTTTGCTTTCTAGACTTCC
GGTTTCCACACCTGGCATGACTCTGGCTGGACCACAAGAAAGAGCTGAGGAGAGAGAGCC
CAAGAATACTTGCTTACATGACAGCTGCAGTTTAGAGGAGTGAGGTAATTAGCTCAGGAT
CATCCAACCAGTAGGTAGGTAGATGTGAGATGATGCAAAAGAAGATATCAACAGGAGTGA
CCCTCTGTCCCTATTGCATGAAATAAGCATGCTTTGCTGTAGAAAAGAAGGAAACCAAAC
AAATCATTAGTACCGATCTGGAAATGGAAAGAAAGGGCATCCCCATGACACCACTGGGTC
CCTGGACTGATACCTTCCAAGGCCAACCCCACATCTCTTCCTTCTACTCTTGTGAACCAA
TAAATTATCTTTTTTGCTTAAAGTAGTATATGAGTTGGGTTGCTATACCTTGAAGCCAGA
ATGTTCTAGTAAAAGTATTCCATATGTATTAAAAAGAATGGTTGGTCCTGATTCAAGGCC
AGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGACTAAATAATTGTCTTTTTATGGTC
TGTTGGCCATCTTATAAGTTTGGAAATGTAATAGCCAATTCATTAGAAAGAAACATCTGG
AGAAAAAAGAATAATGGACAAATATACTGATATAGAAAATGATCACAATAATTATTAAAT
GAAAAAGGTCAAATTACACAATAGTGTTTTTGGTAGTATTCTATTTGTGTATATAGTGTG
TTTTGTGTGATTTTTATGTTACCTTATTTTATTTCATCTTATTTTATTTTTAGCAAATGA
CTAGAGAACAACTGGAAGAATACCTACCACACTGTTAGCAGGAGATGGGATTGGGAAATC
CCCCAATTCTGAACCATTTACTGATGATGAGCATGTATTACTTTCATAATAAAATACTAA
ATTAAAAAAGGAAAGAGAAGAAAGTTAGTCACTGAATGTACCAGATACTTGCCTGCCCAC
AACTTCCTGGTTTCCTTGTTAGGGAGAAAAGATAGAGATAGCAAACAGAATGGGTTCCAT
GGTTAAGCCAACCAAAACTGTATTGACTGAGTCAGTAATTCAGTGAGATATGGACAGACT
TAAGTATGTACAACTGAGAGAGTTTGCATCACCGGGAATTAAATGCCCAGAGTCTAACCA
GTCAATAAAAATACAAAAAGAGTTAAAAAAGCAATCATTCATGTTGAATCCTCACAATCT
AGGGGTGAGGAGTGCAGAATCCTACTCGAGGTACTGAATGGAGACTTGGCATCAACTGTC
TAGAATTTAGAGGGAGGCTTAGCAGGTGCTCAGAATGTGCAGCATCACCACTTCCAGTTA
TGTGGGCTGCAGAAAAGCCCCATTAAACAGTCACTTAAAAGGGAGATATTAAAGTAGAGG
AGTGCCTGGAGAGGGAGCAAAGAGGGTGTCAGCAAGTCAACGCAAGTTAAGAAGGCTAAT
CCAGGCCAGGCACAGTAGTTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGGGGGT
GGATCACCTGAGATCTGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTGT
ACTAAAAATACAAAAAATTAGCCAGGTGTGGTGGCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved