Pongo_pygmaeus Locus Mono:130:SNORA75
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:130:SNORA75
Pongo_pygmaeus
Mono:130:SNORA75
2a
SNORA75
1001..1116
2116
CTGTCGATTTGCAGAGGGATTCCACCAAATTCATGACTACATAATGAGTGCATATTCAC
ATGAGGAAACTATCTCATACCAGGGAAAGAACATTAGAAAGGAGCAGGTAGAACAATGCA
CAGTTATCATATAGGTCCAGGAAATATTTCTGCCCATATTTCTACCAGCCAGTGTGTGAA
GACCTAGTAAAAATGAGACATTGGATAGAATTCACCAAAACGTATGTCCATTTAATGATG
GGGTTAAATTTGCTTTAAAGGCTGCCCTGAACCCACCTATGAAAACTTAAAAGCAATCCT
CAAAAAATAATGCAAACTAAAGTAGTTATATTCCAGAAAACTAAAAATAAATGTCTAAAG
TAATTCAAGGAATTTAGCATCTGAATTCTAGCATTTAATAAAAAACTACTAGAGATGCAA
AGAAGCAGAAAAATATGATACAAATTGGAAAAAACAACATGAAATGGCACAGATGATAAA
ATCAGCAGATAAGGACTTTAAAAGAAGTGTTATAAATGTGTTCTCTATGTTTGAGAATGT
AAAGAAAAGCACAACATGACAATCAAAAATGTGAAATTTTTTTTAATATTACAAAACAGA
CTTCTGTAAGTCAAAAAAATCTAAAATAAGAAATAAGCTGAATGAGATTAATAGTGGATT
GGAAAATACAAAAGAAAATATTAACTACATAGCAATAGAAACTATGGGAAATGAAATATA
GAGGGTAACACCATAGATAAAACTAAGCAGGATATCTCTAATATAAAACAACAATAAGTG
AGCTAACATACAGATAATTGGAATTTCAGAAGGAAAGGAAGTTTGAGGTGGGGGGCAGAC
ATACATAATGAAGAACACTTTCTAATTTGGTGAACTACAAACTGAAGAACTTAAATAATC
TCCAACATAACAAATATTTGGAAAACCAAACCAAGACACCTCATATTCAATTTGAAGAAT
ACCAGTAATAAAGAAAAAACATTAAAGCAGTCAGAGTATTATTATTGGGCTCCTTTCTGT
CTACTGGTAGCAGTCTATGGATTTGCACAAGAGAAAACTAGCGCTATTTTACCTTCTGTC
TTTAAACAGGTATATTTGACCGTTTTGTGAGAAATTCTGGCATTTAAAAAGAGGCAGCCA
GAGAAAAGGAAACACTATATTCAGAGGAATAGAGATTGGAATGACAGCATATTTCTCATT
GGAGGTCAAGCATGTCAGAAAACAATGAATAATATATTTAAACATTGTGACGGCAGAGTG
AACCACCTGTCAATTTAGAATTCTATATACAACAAAAAGTACCTTTCAAAAATTAAAGTT
AAAGACCTTTGCAGACAGGCAAAACTGAGAACATTTATCACCAGCAAATCCATACAAAAA
GCATGTTAAATAAAATTATTTCAGCAGAAAATAAAATGAGGCTAGATGGAAATTTAGATT
TACACAAAGAAATAAAGAGCACTGGAAATGGCCAATATGTGAATACATATAGAACTAATT
TTGATTTAAAAAAATCTTATTAAAATAATTAAATATATAAAGCAAAAATAATAACAATGT
ATTCTGGAATTTATAAAATGTAGAAGAAAAATATAGGACAAAAATTGCACAGAAGACAGG
AAGAGAAATTGTAGAATTTCTTTTAAATTATGCTTAAAGTTCTGGAGTACATGTGCAGAA
CGTGCAGTTTTGTTACATAGGTATACACGTGGCATGGTGGTTTGCTGCACCCATCAACCC
ATCACCTACAGTAGGTATTTCTCCTAATGTTATCCCTCCCCTAGCCCCCCATCCTCTGAC
AGGCCCCAGTGTGTGATGTCCCCCTCCCTATGTCCATGTGTTCTTGTTGTTCAACTCCCA
CTTACGAGTGAGAACATGTGGTTTTGGTTTTCTGTTCTTGTGATAGATTGCTGAGAATGG
TGGTTTCCAGCTTCATCCATGTTCCTGCAAAGGACATGAACTCATCTTTTTTTATGGCTG
CATAGTATTCCATGGTGTGTATGTGCCACATTTTCTTTATCCAATCTATTATTGATGGGC
ATTTGGGTTGGTTCCAAGTCTTCACTATTGCAAATAGTGCCACCATAAACATACGTGTGC
ATGTGTCTTTATAGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved