Pongo_pygmaeus Locus Mono:228:SNORA25
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:228:SNORA25
Pongo_pygmaeus
Mono:228:SNORA25
13
SNORA25
1001..1128
2128
GATGAGGGGCTGTATTAAAAACAGGGAAGTTATGTGAACTTTGACATACGGAACCTTGA
AACATTCAGCAACCTTCATCACTCAGCTTCCAGGAAAGGAGCAGGTGGATTTTATGTCTC
TAAAGCAACAAACTAAGAAAACTGATCTGCCCATGGGAAAAGACCTACAAAAATACACAA
ATGAAGGCCTGAAACAAAGTAGCTGGGCCACCACCAGTCACCCTATATTGAAGCTCAGCA
GTTAACAAAGCATACTCATAAATATGTTTTTATGTCTGTTTTAAATGTGATCACTAGAAA
AGTCTAACGTAAAAGAACAAACTGATTTGAAACAAAGAAAAAAGGAGAACTCCAAGACAG
CAAATAGAGTAGAAAAATAACTTTTTAGAACTTCAATATTCCCAGAGATGTAAGAGAAGA
AATGGCATGCAGGAAGGGATGCTATTTAAAAAGGATTATTCAGACAATACAGAATCCTTA
GAAGATAAAAACAGAATGCAAAAATTTAAACAACAAAACTCAATAGAAGAGTTGAAAGCC
ACGATTTAATAAATATTTCAGAGAGAAGAAAAACTCACAAAGAGATACAAAATACAAGGA
AAAAAGGAATGCAAAATACAAGGAAAAAAGGATCAGGACTGCCAATAGTATACTAATTAA
AAACACCAGAAAGAGAGAAGAGTGAAAACAGAAAGGAGGGAATGATTAAATAAAAATCTC
AAGAAGATCCCTCAGAGTGGAATAACACAAATTTCCAAACTGAGTGCTCAGAATAATAAA
ATAAAAGTTCTTATCTTCCTAAAAGAACATGTCTTTATGAAATTTCACAACACTAAGGCA
AAAGAAAAAGCAAAAAGCTCCCAGAAAGAAAAATTATGGGTAACATATAAAGAGTCATGA
ACAAAAATAACATTAGGAAGTATCCCAAAAACAACAGTAGAAATTAGAAAATAGTGGTGG
GAGACCTTCAAAATTATGAGAAAAAATTATTTCTAACATGTAGATAACTTCAAAGAGGGC
TTGTGGAGCTGCAAAACCGAGAGCTTTTAATGTATGACCAAATATTGAAGTTCTCCATAG
GATGCCATAGTCACTCAGTAGTGCTATATCTTCCTAAGCAGATATAAGACTTAGCTTCTA
ATAATCATGACCTAATAACCCATGATTGGTAATGTAGGAAGTAAATGTCTCAAAGTTAAA
AAAATATTATTTATAACATGGAAGGTTATATCTGAGAAAACTATCAATCAAACCATATTC
CAAAAAGTTTAACTTTTAGGCACCTTACCTTATGGAGTTACTGGAGAATGCACTTAATGA
AAATAAGGGAGGAAACCAAGAAAGCAAAAAACTGGGTTTCAGAACACAAGAAGCCTAACA
CAGCAGAAAGAAGGGTATTCTAGTGATGACGGCTTGTAGTAAGCCAAAGGAGCAGCCACT
ATCAATTGGTGCAAATGGACAGAAGGCTCCAGGAGTTGTATCTCTAAGAAAAAATAATAA
AATACACACACACACACAAACACACACACACCCCACAAGTGAAGGCTGTATTACCTGTTA
CATTGAATCTACTGAGGGGAGAGTTACATTTCTGGCAATGATTTCTACCCCTAGGGCATT
AAGAACCAAAGCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTAACCT
TGTTACATTGAATCTACTGAGGGGGAGAGTTACATTCTGGCAATGATAAACTACCCCTAG
GGCATTAAGAACCAAAGCAAAAAATTAAACGGAGTCAATTATCAACTGAAGAGAATTCAA
GAAGCTTTACCTAAAAAAAGGAAATATAATCATGGACGTCATGTGGCTGAGGAGTGACTA
ATAATTTTGTAGAATTTTTGACATAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved