Pongo_pygmaeus Locus Mono:213:SNORA1
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:213:SNORA1
Pongo_pygmaeus
Mono:213:SNORA1
8
SNORA1
1001..1133
2133
ATGCCTGACTAATTTCTTTTTATTTTCTGTAAAGATAGGGTCTCTCTATGTTGCCCAGG
CTGGTGTCAAACTCCTGGGCTCAAGTAATCCTCCTGCCTTGGCCTCCCATAGTGCTGGGA
TTACAGGTGTGAGCTACCATGCCCAGCCTGGATAAAACACTTTAAATTCTACATTTAGAA
TAATAGCCAGGTTAATCATACATAGGTAACAAGTTACTTTCAAAAGGAAGGTCTCAATAA
ACCTCAATTATTCAGATTAGATTATCAACATAGAAACAGAAAGAGCTTACGGTGAAAAAT
ATCTTTCCAGGAAATGATTTATCCCTGATCTTAAAGGGAAAACTTAGAAAAGTAGCAAAT
TTTCAACCTATTCAGCTCATGAAAAGTTGGTAATCAAAAACACTCAAGTAGTTTTTTAGT
CTCTTGTTGAAGTTTATTTAATCTTTGTCTACTTTCCCTCACAGGGCATGATACTGGAAT
CTCTCTGTTCTTTTGAATAGTTTAAATAAACACCTCAAAGAAGAGCTGCTCACCATGAAG
ACAACTTCCCATTCAAGAAAGTACAAGGCCCGGCACGGTGGCTTTCGCCTGTAATCCCAG
CATTTTGGGAGGCCAAGGCGGGCAAATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGGC
CAACGTGGTGAAATCCCGTCTCTACCAAATATATAAAAATTAGCTGGGCGTAGGCCGAGC
GCAGTGGCTCATGCCTGTAATCCCAGCACTGTGGGAGGCTGAAGTGGGCGGATCACAAAG
TCAGGAGTTCGAGACCAGCCTGGCCAATATGGTGAAACCCTATCTGTACTAAAAAATACA
AAATTAGCTGGGTATGGTGGCACACACCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAG
GAGCCTCTCTGGAACCCAAGAGGCGGAGGTTGCAGTGAGTGGAGATTGCGCCACTGCACA
CCAGCCTGGGTGACAAAGAGAGACTCCATCTCCAAAAAAAAAGCCTCATGCTAGATGAGA
ATGGGCACTGTTGATCATGGTGTCCAAAAATAGTTAATGTGGCTAAATTGAGACAGGTTA
TGTTTCCATCACAGTATGCATATTGCAGTGGTGATAATGAGACCTGTAACATTTTGCCAT
GCTTATGAGTAAAATATGTAGGAGAAAAATGTTGACTTTAAAAATAACATTTAAGTAATA
AGAAATTTTCAGCTCTTATCTCATAGGACTACTGTTGTTGCTGGTTTTTTTGTATGCTAT
ATATTGACTGAAACATTGTAATGTGGTACGTGACTGTGTCTTGGATCAGGTGTCAAAATG
TAAGTGTACTTTGTACAATTCAACTTCTAGAAAAAAAAAAATTAGCTGGGCATTGCGGAG
CGCACCTGTAATTCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAG
GTGGAAGTTGCAGTGAGCTGAGATCACGCCACTGCACTCCAGCCTGGGCTAGAGTGAAAT
TCCGTCTCAAAAAAAAAAAAAAAGAAAGAAAGTACACTGTTACGGCCAGGTGCGATGGCT
CACGCCTATCATCCCAGCAGTTTGGGAGGCCAAAGTGGGTGGATCACCTGAGGTCGGGAG
TTTGAGACCAGCCTGACCAACATGTAGAAACCTTGTCTCTACTAAAAATACAAAATTAGC
CGAGCGTGGTGGCGCATGCCTGCAATCCCAGCTACTCGGGAGGCTGAGGCGGGAGAATCG
CTTGAACCCGGGAGGCGGAGGTTGCTGTGAGCCAAGATCGCACCATTGCAGTCCAGTCTG
GGCAACAAGAGTGAAACTCGTCTCAAAAAAAAAGGAAGTACAGGTACGTTTTTCAGAATG
ATGATACATCACTGACTCACTTCGTTTCTGCAACCAGATCCTTTCCTGTGTCTGTGCAGT
CATGACTCCATTGCTGCCCTGAGGTGGTATATTAACCCAAATCACAGTCTGAATGTCATT
TCTGGTTTAGGTTCTTCCCTATTTATCTTTGGTTGAGCCAGGAAATGCAACTTGATAATG
ACTCAGCACAAGCTATTCAGCTGGGAGCTGGTTCCTAGCCACATCCAGCTCTGCACTGGA
AATATCTGAAGTGGTCAGTCTAGGATACAGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved