Pongo_pygmaeus Locus Mono:337:SNORA57
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:337:SNORA57
Pongo_pygmaeus
Mono:337:SNORA57
5_random
SNORA57
1001..1145
2145
AAAAAAAAAAAAATTCATAGGGTTGATATTGACAATATCAGTTTTGTCAGTTGATTTGT
GAGATTTATATCTCAGGACTTAATTTGAGGAAATACAGTATAGAGCAAAAGGAATACCCA
GCTAATAATGTGCAAGTTTCTCAAAGCTTTTATGAGCATAGTTTGCAACAATATAGTATT
TCTTTCTTACTCTTTCTGAACATTGCACTTAAGTAAGCTAAAAATAAAGCTTAGAATTTT
GTAATGATGGTAGTCATAGATAAAATTTAAAAATAGTAAATGGCCAGGCACAGTGGCTCA
CACCTGTAATCCCAGCACTTTGGGATCCTGAGGCAGGAGGGTCACTTGAGTCCAGGAGTT
TGAGTCTGCACTGAGCTATGGTGGTGCCACTGCACTCCAGCCTGGGTGATAGAATGAGAC
CTTATCTCAAAAAACAAAACAAAAAAGGATTAAGTTACATCTAAGATATTTCTGTCTTTA
CCCATGAATCCAACCCCAAGAGAATACAGTTTCTAGTAGTTTTTTTCTGTTGTGTCAAAA
TATCTTTTTCTTTATAACTGGATAGAATTTAACATGTTAGTCCCAGTTCTGCTTTATTGA
TTTCGTAGCAAAATCTTGCACAAGCCCAAATACCAATATGTTTTATGGTTCTGTTGAACC
TACTTTTTGATTCTTGTCCTTCTTGAAAGCAAGAGGGCTTTGACTGCAAAAACCCATTAA
AGGAGAAGGACTTGACAAATGAGTACAACTTCAAGTAAAGTATGTTTATACACATTTTTG
CCAGGCTGTTAACATTAGAATTTCTTAAGCAGAGGAAACTTCAGATAGAAGAGGGAGAAC
ACCTCGAAGAAAGAGTCCTTTGTACTCCTAGTGTATTTCTTAGGAAACAATTAGCCCTTC
CCTTGATCGTGGTCTCAGGACAGGCAGCAATATGCTTTTGATAATTGATGTATGCTGCCT
AGGAATTATTTTGTTGTTTGGTCACTAAAGGTCAATGCCACCCTCTCTTTCTTTGCAGGC
AGCCCGTATGTATGTTCCCTATTATGTCTGGAGGCAGAGGGAAAGGGCTTCAGTCCCCTG
GGCATCATGACTTTGGTGCTGGTGGCTTCCTGTCTGCCAATTCTATCCTCAAGCACTGGG
ACACAGGGGGAAAAAAAAAAGCCAACTTCTGTGCCATCCTAAGTATGGGTTCACATCTTT
GAAATCTTATGGAGCCTTAAAACCTCTCAAATGGGTTGATGATAGAGTTTCACTTTGGGA
GGGTAGGTGAAAATCTAGATCCATGTTAAACATTTATTCAAGTAACTCCTAAAGCCAGGA
GGCAGGATAGTCTGGTTAAGAACATGAACTTTGGAGTCAGTGTTGGTTTGAATCCCTGTT
ACACTATTTAGTTCTGTGATCTTTGAGAAATAGTTACTTCTTCTAATTCAGTGTACATTT
GTGTGTTTTCTTTGTGACAGGCACTGTTCTAATTGTTTGAGAAATATTACCTCATTAAAT
CTTTATAACATCCTGTGAAACAGATATTATTGTCATCTCCCTCATCTTCCTTTCCATCCC
AGCTTTACCCCAGGTAATCGACATCGTTATTTGCAAAGTCAGTTATACCCTATACTTCAG
GAACCATCTGTATTCTGAATTTTACTTTCACCAGTTTTATACTTTGAAATGTTTTGTGTT
TCTCATTGACATCCTTTCTTTCAGCTTCAAGAATTACCTTTAGCATTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCCTGGTTGTTATCTTTCAGAGCGTCCAAG
TTCTGAAAGCCACTTGCAACCCAAAAAAGAACTTTCCATCATCAGTGGACATATGTCAAA
GAAGAGAAACATTAGTAATAGGATCCAGGCCATGTAATGTTCATTAAACAATTAGATGCT
GGTGCCAGTGTGTAATCACTTTTTTCCATTTTATTTTCAACAGTTTGAGTGTTCCTAAGA
GGCTTGCATGGGATTGAATCTGGTACTTTCATCAGAATTTTAGTGTATTTTCAGTATTGG
TAACATCTCCTCTCTCCTACTTACACTTTGCAACAGACTCTCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved