Pongo_pygmaeus Locus Poly:5:SNORA71
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:5:SNORA71
Pongo_pygmaeus
Poly:5:SNORA71
20
SNORA71, SNORA71
1001..1136, 2316..2451
3451
TTAGTGCCTCTTGAGAAACGGCTCGGCAACGCTGCGCCCGGGGCCTTGCACGCGGGCTG
AGGGGGGCTAGAGACCTCGCGACTTTCACTCCCCCGGACCCCGATTTCCGACTCCTGACT
TTGGAAGCCCCCCAAAGCTGCTTTTCGGTTGCCTACAAAGTGTCGGGTTATTGTGCCATG
TCCCTTGGAACCGTGAACTCATTTGTCTCCTCAATAACCTTGAAAAAGTAGCTGTANAAA
CCTCCATTTTACAGACCAACTTGGCCTGAGGGTTTAAATCGGATGGACACTTCCCAGGGC
CCCAGAGGGGTGAATTCCAGACTCCTTTGCCAGGACCTTGTTACTAAGCCCCTTCCCTAC
GCTTTTCCCTGCCTAGGCCTCGTGGGCTGTGCGGCTCTCCTGGAGACAGATGACAGCTCT
CCCTTGGATGGCTTTGCTAGTTTCGCACCAGCCAGCGCCCCATTTTTCCTGCAGCACCCT
GATCCGCACTCCCTGAGGGGCTCCCACTGTCCGCGGATGTGAGGATGTCCCTGGGTAAGT
GGTGCTGGTCATGAGCACCTTGGGGGACCCTTCAGATTCGCTTCTGGGGGACCCCAGCGG
AGGGCATAGTCATGAATTCCGAGAACTGTATGGCAAAGCCGAGTGCAGAGGAGAGCCTGG
CTAAGTTCTTTCATTCTCCTGAGCTTGACTTTCTGTAATGTAGGGAAACTGCGAAAGCTC
TGTAAGTGGGGAGATCTTGCACGTTTTTCTGTGCTTTTGAACCTATGGATGTCTGGGCTA
GGTAGATATTCAATATTTGTGGGGATGAATGAACAAATTTAAGTCCTTTTTTTTTTTTTA
AACCAAAAATTGGTCTTCTGTGACTTTCTTGATGGGGGCAGGTGAGATGTTTGTACTGCA
TTAAGTGGATAGCGCTCAGGTCCTTTGGGCTTGGCGCTTTGGCAATCTCCAAGCAGCTCA
CTTTGGCCTCAGGTTCCTGGATCCCCTCTGTTCTTTTCTGCGCCTGCATTCGTTAAGTGA
TCACGGGGCTGCCCATGTCCTGGTCATTGGTAGTGCAGGCAGAGGAAATGCGGGGAAAGG
TTTGCTGTGTTTGGAGGATCCACATCTTCACCTTCCTGTCCCAGGAGCTTTCCTACACTC
CTGCTTCTCAAAGCTGCACACACCTGGGGCCTCCAGGGGATGGGGGCTGCCGTGTGTGTT
ATGTCATGATTAGAGCTTTCACTTCCTGCTCCCTGCTGTTGGGAACCAGGCTATGTGTGT
TGCTTAAATTCCCCTTGATGACCAGCAGAGTCACCGCCACTCAGCCGTGGCACACTGCTG
TAAACCTGGTTTTGATCTCCTTTCAGTCTTTTGCTGATTAACTGCACATTGATCAGTGTT
GGCCACCCCTCACCCCTGCCATAGACCATCCACTGTCTTCTTCTGTAGAGTTAACTATTT
TCTCTTTTATGAGGAAATAGTGTGTTTGCCTAGGAATGTTTACTGTCTGGTAAACTACTG
TGCTAAGCCCCTTTCCTGTTGCCTGCCATCCTTGCTGTGAGCAGGGGCAAGCTGGGTGCT
CATTCATGGCATCTTTATTCTGTTGCAGATAGTCCACTGTGTGCAGAGGCATGGGAGTTG
TCATGTCGATANCATGCTAGACCTCGTGGGCCCCGAGGTAAGAGCTCTAGATCACTGTCT
GGAATGTTGGTTCCTTGTATATAGTACAGTTCTGTACATGTTCCCAGGGGCTTTGGGGTT
GGTGTAGGGGAGCTGAGAGGTGAGATGAGAATGGCACTGTGGGTCCCCAGATCCGCTGTC
CACCCAGCCAACCCAGATAACCTCTGGCCTTTCTATGTGCCTTCAGGGCTTGCTGCTGGG
GGGAAACCTCCAGAGTCCCACTTTGGTAATAAGAGGTCTCTGCCCTTTCTCCCCTGGGCA
GCAGGATGTTGTAATGGAAAATGAGTGGACCTAGGCTTCAGAGACTCTGGTTCCCCTGGC
TTTGAATCCCCTTCTGCTACTATCCCAGTCAAGGACTGATTCGAGAACCTAATTTTCTTC
ATTTGGAAAATAATGTTCTGATAGAGGTGACTTTTGTGGTACCTGAGACCACATGATTCC
TATCATTACCAGCCAATATTGTCCCATTGTTTTTGCCCCCCATGTGACTTCTACTGTGAT
TCCTCCTGGCAAGGAAGTTCTATGTGGTTTTTACAGGAAAGCAGGGTCCACTTTCGGGGT
CCTGTGCTGGGCTGGATTGTTTTCCTGGACTGGACCTAGTCCATAGGCCTGCTGGCATCT
GTTTCTCTTCATAGATCTCTCTCTGCCCTTGTATATACCTGCATTCAAAAAATGATCATG
GGCTTCCCTGTGCTCGGGTCATCGATAATGCAGGGAGAGGAATTGCTGAAAGCCGTTTCC
CGTGTTTGGAGGGTTCACATCTGTCCCTTTCAAATGCTGGCGCTTTCACACACTCCTCTC
CTGCCAGCACCTTCTGGTCTCAGGAGCATTGCAGGATGCTGTGTGAGTGAGTGATGGGAG
ACACTTTAGTGTGACTTTTTTCAGCTTAGCTTCCTGTTATCAGAGAGCAGTCTCTCTCAG
TGTCAAGGTTTGGGTACTAGATGGTGGAAAAAGCCTGTGTGAATTATTTTTAATGAATAA
GTGTGATGTTGGGTGGCATACAGTCACTGCCTTAAGATTTTCAAAGAGAAGCAGCCTTTT
GGAGGTGGTGGGCCTGGGCAGGTCTTTCAAGGAGTGGGATGTGATGGGCAGTAGAAAGGT
ATTCCAGGGAGGGGTAGCAACATGAGAAGGTCTTTGAGGCTGGGATGAGCAAGAGTGTCT
AGTCCCACCAGGGAGACAGATGTGTAGGCAAGTAATGAAAGCATGGAGGGATGGCTGCTG
GGGTGGTCCTTGGCTCCCAGCATGGCGAGGTGGGACATCTATGGGAGGGGCCCTGAGAGG
TCTCTTGAGCTGCTCTTTCTTANAGATNAGCCAGTTGCACATCTGCTCGGTTGCCTGTCA
AGACTCTTAAGACAGTTTTGCTAGACTCTTAAGTTTTTATTTTGATATTCTTCGGGAGCA
TTGAGATTCCTTTTTGAGATGAGTTTGGTATGAAAGAAACTGGCAACTCATACCCGATTG
ATTAAACTGGGGGCATTCCCATTGACATCAGCTTGAAGAAAAGACAACAGAACACTGGAG
ACCAAGTACTTGCAGCCTTCTGCTCTGTGGCCCCTCCTCACTCCAGGGATGCCGCCTTGG
GTCTGGAGACTGTTAGAGGAAACCCCAAGAGGTGCAAGCACTGAGCCTCTCAGGACAATG
ACCTGGGATTCCACCTCCCCTGGAAGGGGGCCTCCTCAATGGTAAGCGAATGGCCAAGAG
GTTAAGTCGGGCCTTGTGATTTCCGAGGTGGAAAATTCGAAGCCGCTGGCTTGATTTGTC
TTCTCTTTTAGATTGTTTGGGGGGTTGATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved