Pongo_pygmaeus Locus Poly:14:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:14:SNORD115
Pongo_pygmaeus
Poly:14:SNORD115
15
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1082, 2860..2941, 5186..5267, 6944..7025, 8763..8844, 10684..10765, 12009..12090, 14197..14278, 16130..16211, 18004..18084, 19869..19950, 21894..21975, 23801..23882, 25400..25480, 27410..27491, 29075..29156, 31175..31255, 35090..35171, 36851..36932, 37985..38066, 40154..40235, 41288..41369, 43190..43271, 44325..44404, 46226..46307, 47356..47437, 49262..49343, 51001..51081, 52836..52917, 54714..54795, 56748..56828, 58832..58913, 61902..61983, 63983..64064, 65864..65945, 66766..66847, 68665..68746, 70521..70602, 72392..72473, 73929..74010, 75802..75883, 77882..77963, 79782..79854, 81615..81696, 83517..83598, 85385..85466, 87252..87333, 89116..89197, 90966..91047, 92628..92709
93709
GGTAAGATGAGGAAAAAGCATAAAACGGTCAAAAACACTGGGAGAATTGAAGGTTCTTT
TTGACAATGGTAATACAAATAGAAAAACTGACAAAAAAGAAAATACATCTTAATTAGAAA
ACATACAAGAGTAGTTGTATACAAATGAAGACACGTACCAAAAATAAAGAAGTTACAAAA
TATGAATGCATATACATAAAAAATGTAGTTTCAAACAATTCAAAAGTAAAATGATGCAAG
ACATTAAAATATTCACAAACACGCTGGAAAAATAAGAGCTGACGCCCGAAATTAGACCAG
TTCAACGGAAGTGTGGGGTGTGGTTGGGGACCCGCCGCAGAAATCACGTGGTGCCCAGGC
GAAGGCTGCAATTTCCCATGCACGCTTGGAGAGGACGCCTGGGAGGGCGTCCACCATGCC
CAGGGGCAGGCTATGCGACTGCCAGGTCTGCAGCTGTGAGTGGTTTCTGGGCCAGCCTCT
TTGTTTGGTCCTAACCTGGTTGGTGGCCCTAGCCTGTGCCGAGTGGTCCCGGAGTGGCCC
AGGGGGTTGTGTGCGGGGAGCTGGCGTGGGCAGCGGAGGTGCTCCCTGGGGCCTGCAGTA
GGGCACAGCTTCTGCATCTTGCGCGAGCCCAGTGACCCGCCTATCCTGTCCTTCCAGGGT
TGGGTGGCGGGGAGGGCCAAGGGTGCCCCGCGTCCGTGACGGGTCAGCGTTTCCAGCAAA
TGGGTCCACGGAGGGAGAGCATACCTGAGCCGCTGCACCCTACCGCCTTCATGAGGTTCT
GTTTGGACATCTGTCCTACTCCTGTTCCCCCAGATGGTGACCACGGAGGAAGTACTTGTG
TTGGGCCCAATGGCCCTCAGCCAGTGTCCATCTGCCAGGTGCCAGCCCCCGGTGCGCTGA
AGCTCAGGCCATTCCTGGCACCCTGGCCTCCTGCACTGAGCTGTGGTGAGCCCATCCGGG
TCCTGCTGGATACATGCGCGGGGAGGGGGGTGCCCTGGATTGGGTCGATGATGAGAACCT
TATATTATCCTGAAGAGAGGTGATGACTTAAAAGTCATGCTCAATAGGATTACGCTGAGG
CCCAGCCTAGGTGAGAATTTTGGAGGAGAATGCTGGGATCCAGAGGCCCCTGACAGGGCC
ACTGTATTTTGGGCTGCAGACCTAGAGGCCCTGAAGGGCATCTGAAGGGAGCCCAAGCCT
ATCTCTGAGCTCCCCCATGAGGCAGTCCAGGATCCCTGTGTGGGCATATGCTGGGGCTCT
GGTTCCCTAGGGGCAGGGCGTGTGGGTGGCTCCTCCCTGACCCCCATTCTCCCCTATGTC
TTTCAGTGAGCTCTTCTGCCCAGGCAGGCCCCCTGGCATTGACCGGCATAGGTGAGTGGA
TCCTGCTGGGGTCATGGGCCATGAGCCAGGCTGCTGGGGTTGCCGAGGGTCAGCCTTTGG
GACAGCCTCCCAGAAGGGCAGCTTCCTTGGGAGTCTGACCCAAGGAGGATATCTTCTCTA
AAGCCCTGCAGTGGTGAGGGTGGTCCAGGCAACATAAGGGTTCCTTCAACCCCACCCAGG
ACAGCGCCCAGCTGAGACTCAGTGTGCAGGTCTGGCCACGAGGACTGCCCAGGCCACATG
AGGGGGTCCATAGGAGCTCTGGGGCACTACAGGGGTCACACAGGAGCTCTCCTTCCCCAG
AGAGGGGTGAGCGTTTGGGCCTATGGGGTCAGGCCTTTGGAGATTCAAGGATTGGGCCCC
ACCCATGACCCTGAATGGGACCGAGCCTTTGAGCAATGAACCATCCCAGTGGTGCCTCTG
AGCCTAGTGGGGGGCAATGAGGCTTCAGCGGGGTTGGGTCAAGGCTGAGCTCTGGCTGGT
GCCTGGTAGTGCTGCAGGCTGGCCCTGGGATTCGCTGGCTTTGGGCAAAGGGTCCAGCCC
ATGTCCCGCTGGGGGTCACCCCTTCCCTGCGGGCAACTAGCGGGAAGGGTGGCATCCTTA
GGTGGGAAGGTCCACTGTCGAGGGTCCTGTCCCGGGAATTTGCCTCCCAGGCTTCTTCTG
ATCCACGGACTCACCTTCAGGGTGGTGGGGTCTTGGGTCCGAGGAAAGGAGAAGATACCA
TGTGTTCCCTGATTGGCCGAGTGTGGCTCGGCTCTGTGTTTGGGAGGTGTGTAGGGTATG
AATGGGGACCCACCAGAGAACACAGGGCCCCAGGTTATGATTTCCCATGCACACTTGGAG
AGAACTCTGGGTGGGTGCCCTCCACTCCCAGGCACAGGCTATGCAACTGCCAGGTCTGCA
GTAGCATGTGGCTTCCAGGTCAGCCTCCTTGGTTGGCCATGAGCAGGTTGGTTGCCCTAT
CCTGTGCCCAGTGGTCTCGGAGTGGCCCAGGGGTCCTGCAGGGGAGCTGGCGTGGGTAGT
GGAGGTGCTTGTGGGGCCTGCAATAGAGCGCAGCCCAGGTGTCTTGCACGAGCTTAGTGA
CCCACCTGCCTTGTCCTAGTCCTAGCTCAGTGACCCACCCCCCGCTCCCTGCAGTGACGG
GGAGTACCAAGGGTCCCCTGTGTCTGTGATGGGTCAGTGTTCCCATCACATGGGTCCATG
GAGGGAGAGCATGCATGAGCTGGCACCACCCACCACCTTCCCCCTATGGAGGCGTGAGGC
CATGTTTGGACACATGTCCTCTTGTTCCCCCAGACAGTGAGCCTGGAGGAAGACTTGCCT
TGGTCCCACTGTCCCCAGGCCAGTGTCCATCAGCCAGGTGCCCAGCCCCCGGTGCGCTGA
AGCTCGGCCCTCCCTGGCACTCTGGTCTCCTGCACTGAGCTGTGGTGAGCGCATCCAGGT
CCTGCTGGATGTTTGCATGGGGAGGGGGTTGCCCCGGGTTGGGTCGATGATGAGAACCTT
CTATTTTCTTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCTGGCAGGAGGGATTTTGGG
CTGGAGACCTGGAGGCCCTGAAGGGTATCTGCAGGGGCCCCAACCCTGTCTCTGCACTTG
TCTGTGAGGCAGCCCAGTTTCCCTGTGTGGGCTTGGTGTCACTGCTCTGGTTCCCTGGAG
CAGGGCACGTGGGTGGCTCATCCCTGAAGTCACATTCTCCCTTTGTGTCTTTAAGTGAGC
TCTTCCACCCATGAAGGCCCCCTGGCCTTGAGCAGCATAGGTGAGCGGATCCTGCTGGGC
TCATGGACCAGGCCACGTGGGGTCACTGAGGGTCAGCCTTCAGGACAGGAGGGATTCCTC
AGGGAGACAACCTGAATCCCCACTGGTAAGGGATTGGTTCTCCAGGAGGGCCGCCTCCTT
GGGAATCTGACCCAAGGAGGACACCTTCCCTGAAGCCCTGCAGGAGTGACAGTGGTCCAG
GCAGGAAAGAGTTCCATTAGTCCCATGCAGGGCAGCTTCCAGCTGAGACTTGGTGCTAGG
GTCTGGCCTCGAGGACTGCCCAGCCCACATGAGGCAGGGTCCCAGGCTGCTATTTCCAGT
GCATGCTTGGAGAGGGAGCCTGGGTAGGTCCCCTCCCTGTGCAGGGGCAGGCTGTGCATC
TGCTGGGTCTGCAGCAGTGCCTGCCTTCAGGGCCAGCCTCCTTGGTTGGCCTGAGCTGTA
TAGTGGCCTTGGCCCCACCCAGGGGTCACGGTGCAGCCCAGGAATTGTAGGGGAGCCAGC
ATGGGGAGTGGAGGTGCTCCAGGGGCTTGCAGTAAGACACAGCCTGGGCATCTTGCTCGA
ACCCAGTGACCAGTCTGCCCTGTTTTCCAGGGTTCAGTGGCAGGGAGGACCAAGGGTCCC
CCACATCCATGACTATCACTGTTTCATATGGATCCCATCACGTGGGTCCATGGAGGGAAA
GCATGTGTGAGATAGCACCCCCTGCCTCCTTTCCCGCATGGAGGCATGAGGTTCTGTTTG
GACGCTTTTCCCTGTCCCTCCAGATGGTGAGGGGGGAAGGAGGACTTGTGTTTCCCTGTC
CCTCCTTCAGGGGAAGGAGGACTCGTGTTGGGCCCAATGGCCTGGGGCCAGTGTCTGTCA
GCCAGGTGCCCAGCCCCTGACGCGCTGAAGTTTGGACCCTTCCTGGCGTTCTGTTCTATC
GGGGGAACCCGCCCCCAATAATTCAACGTAGGTTCTTTTCTATTTTTCCCTAAGTGTTGG
CCGGTCTGAGAAATAAAGGGAAAGAGTACAAAAGAGATAAATTTTAAAGCTGGGTGTCCG
GGAGAGACATCACATGTCGGCAGGTTGCATGATGCCACCCAAGCTGCAAAACCAGCAAGT
TTTTATTAGTGATTTTCAAAGGGGAGGGAGTGTACAAATAGGGTGTAGGTCACAGAAATC
ACATGCTTTACAAGGCAATAAAATATCACAAGGCAAATGGGGACAGAGCACTGAGGCCAA
ATTAAAATTGCTAATGAAGTTTCGGGCACGCATTGTCATTGATAACATCTTATCAGGAGA
CAGGGTTTGAGAGCAGACAAGCGGTCTGACCAAAATTTATTAGGCAGGAATTTCCTCGTC
CTAATAGGCCTAGGAGCCCTATGGGAGACCGGGGCTTATTTCTTCCCTTATCTGCAACTG
TATAAGACAGACATTCCCAGAGCGGTCATTTTAGAGACCGCCCCTAGGAACGCATTCTCT
TTCTCAGGGCTGTTCCTTGCTGAGAAAAATAATTCAGCAATATTTCTCCTATTCGCTTTT
GTAAGAAGAGAAATATGGCTCTGTTCACCCGGCTCTCAGGCAGTCAGACCTGATGGTTAT
CTCCCTTGTTCCCTGAACATCACTGTTATCCTGTTCTTTTTTCAAGGTGCCCAGATTTCA
TATTGTTTAAACACACATGTTTTACGAACAATTTGTGCAGTTAACACAATCATCACAGGG
TCCTGAGGTGACATCCTCAGCTTACGAAGATGACGGGAGTAAGAGATTAAAGTAAAGACA
GGCATAGGAAATAATAAGAGTATTGATTTGGGAAGTGATAAATGTCCATGAAATCTTCAC
ACTTTGTGTTCTTCTGCCATGGCTTCAGCAGGTCCCTCCATTCGGGGTCCCTGACTTCCC
ACAACACTGGTCTCTTGCACTGAGCTTTGGTGAGCCCATCTAGGTCCTGCTGGATGCATG
TGTAGGGAGGGGGGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAG
AGAGGTGATGACTTAAAAATCATGCTCAATAGGATTATGCTGAGGCCCAGCCTAGGTGAG
AATTTTGGAAGAGGATGCTGAGATCCCAAGGTCTCTGGGAGGGCCGCTGTATTTTGGGCT
GGAGACCTGGAGGCCCTGAAGTGCATCTTAGGGGTGCCCGACCCTATCTCTGTGTTCCTC
CTTGAGGCAGCCCAGGCTCCCTTGTGGGCTAGGTGTCGGCCCTCCAGTTCCCCGGGGTTG
AGGCACATTGGAGGCTCCTTCCTGAGCCCCCATTCTCCCCTGTGTCTTTCAGCGAGCTCT
TCTGCCCAGGGGGACCCCGGCCTTAAGTGGGATAGGTAAGTGGATCCTGCTGGGGTCATG
GACCATGAGCCAGGTTGCTTTGGGTCACTGAGAGTCACCCTTCAGGCCACGGGGGATTCC
TCAGGGAGCCCATCTGAAACCCACCGGGGATGGATGGTTTCTCCAGGAGGACAGCTTCCT
TGGAAATCGGTCCCAAGAAGGATGCCTTCCCTGAAGCCATGCAGAGATGATGGAGGTCCA
AGCAGGAAAGGGTTCTTTCAACTCAACGCAGTGCACATCCTAGCTGAGACTCAGTGCACA
AGTCAGGCCTGGAGGACTTCCCAGGCCACATGAGGGGGTCCACAGGGTCTCCGGGGACCA
CAGGTGTTATGAGGGTGCTCTCTGTCCCCGAGGCTTGCAGACGGGCAGGGTGTGGGTGAT
TGGACTTATGGAGTCAGGCCGTGAAGATTCAAGGATCAGGCCCAACCCATGGCCCAGCAG
GGATCGAACCTGTGGAGCAATGGGCCATCCCAGTGGTGCCTCCTTGAGCCTCGTGGGGGC
GGTGTGGCCTTAGTGGGGTTGGGTCAAGCCTGAGCTCTGGCCTTCACCTGGTGGTGCTGC
AGGCTGGCCCTGGGAATTTGGGCTTTGGGCCAAGGGTGCAGTCTGTGTCCCACTAAAGGT
CACCCCTCCCCGAAGTGGAGCGGCCAGAAGGATGGCATCCTGTGGTGGAAGTCCCACTGT
CAAGGGTCCTGTCCTGGCAATTTGCTGCCCAGGCCACTTCTAAGCCATGGGGTCACCTCC
GGGGTGGCGGGGTCTTGAGCCGAAGGAAAGGGGAGGACATCATGTGTCCCCTGATTGACT
GAGCATGGCCCAGCTCTGCGTTTGGAGGTGTGCGGTGCATGAATGGGGACCCATCAGAGA
AAGCTTGTGGCCCTGGGGCTCCAGGATTTGATTTCTGGTGTGAGCTTGTAGAGGGGGTCT
GCAGTGGCACATGGCATTCAGGTCAGCCTACTTGGTTTGCTGTGAGCTGGTTGGTGGTCC
TGGCCCTGCCCAGTGGTCCCGTTGTGGCACACAGTCATGCGGGGGAGCTGTGGCAAGGAG
GGCCAAGGGTTCCCCACGTTCATGACCATCACTGTTTACATGGATCCCATCTCTTGAGTC
CTTAGAGGGAGAGCATGTGTGAGCCAGCACCCCCTGCCCACTTTCCTGCATGGAGGCATG
AGGTCGTGTTTCTATACCTGTCCCCAACCCCTCCAGATGGTGACCCCAGAGGAAAACGTG
CATTGGGTGCGCTGGCCCCAGGCCAGTGTCTCTCAGCCATGTGCTCAACCCCTGGTGAGC
TGAAGCTCAGGCCCTTCCTGGCATCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCT
GGGTTCCTCTGGATACATGTGCGGGGAGGGGGATGCACTGGGTTGGGTCAATGATGAGAA
CCTTATATTGTCCTGAAGAAAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTG
AGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCGAGTTCCCCGGCAAG
GCCACTGTATTTTAGGCAGGAGACCTTGAGGATCTGAACGGCATCTCCGGGGGGCCCAAC
CCTGTCTCTGGGCTCCTCTGTGAGGCAGCCCAGGTTCCCTGTGCAGGCTTGGGCTCCGGT
TCCCTGAGCCCCCATTCTCCCTTGTGTCTTTCAGTGAGCTCGTTCACCTAGGTGGGGCCC
CCAGGCATTGACCGGCATAGGTGAGTGGTCCTGCTGGGGTCATGGGTCATCAGCAGCATG
GGGTCACCAAGGGTCAGCCTTTGAGACAGGAGGGTTTCCACAGGCAGCCAACCTGAATCC
ACACCATGGAGGGATGGATTGGTCCTCCAAGAGGGCTGTTTTTTTGGGAATCAGACCCAA
GGAGGATACCTTCCCTGCAGCCCTGCAGGGATGATGGTGGTCCAGGCAGGAAAGGGTTCC
TTCAGTCTCATGCAGGGCAGCTCCCAGCTGAGTCTCAGTGCATTGGTCTGGCCTCGAGGA
CTGACCAGGCCACATGAGGGGGGCAACAGGGGCTTCGGGATGCAGTGGGGTTACACAGGA
TCTCTCCATCCCCGGAGAAAGGTGGGCATAGAACCCATGGATTCGAGCTGCAGAGATTCA
GGAATCGCACACGAATTATTGCCCAGAATGGGACTGACCTGTTGAGCAATGTGCCATCCC
AGGGCACCTCTTTGAGCCTGAAGGGGGTGGTGCTGTTGCCCTAGGTTTGGGTCAAGGCTG
AGCTCTGGCCAGTGCCTGGTGTGCTATAGTCCTGTCATGGACTCGTTAGCTTTATGCCAA
GGGGTCAGCCCACGTCCTACTGGATATCTCCCCTTCCCTGTGGCTGGAAGTCACCCCTTC
CCCATTGGCAAGTGTCAGGAAGGGTGACCTCCTGAGGTGGAAGGCCTGTCGAGGGTCTTG
TCCCTGGAATATGCTGCCCATGCTGCTTCTGAGCCGTGGGGTCACCTCCAGGGTAGCGGG
TCTTGGGCCCAAGGAAAGGAGAAGTCACCATGTGTCCCCTGATTAGTCGAGTGTGGCCCT
GCTCTGTGTTTAGGAGGTGTGTGGGGCATGGATGGAGACCCACCAGAGAAAGCATGTGAC
CCAGGGACCCAAGGTTGCAATTTCTAGTACATGCTGGGATAGGGCACCTGTGTGGGTGCC
CACAGTGCACAGGGATAGGCTATGTGACTTGCAAGTCTGCAGTGGCATCTGGCATCTGGT
CCAGCCTCCTTGGTGGGCCGTGAACTGAATGGTGGCGCTTGCCTGTGCCCAGTAGATCTN
NNNNNNNNNGTCGGGGCTTCTTGACCAAGCCCAGTGACCCGCCTGCCCTGTCCTTCCAGG
GTTCAGTGGCTGAGAGAGCATTGGTTGCCCTGTGTCCGTGACGGGCCACTGTTCTGCATG
CATCCCATCACATGGATCCATGGAGAACGAGCATCCCTGGGCTGACACACCCCACCTTCT
GCCTCCATGGAGGGGTGAGGTTGTGTTAGCACACCTATCCTACTCCTGTTTCCCCAGATG
TTGAGCCCAGAGGAAGACTTGTGCTGGGCCCAATGGCCCGGGGTCATCGTCTGTCAGCCA
GGTGCCCAGCCCCTGGAACACTGAAGATCAGGCCTTTCCTGGCACCCTGGTCTCCTGCAC
TGAGCTGTGGTGAGCACATCCATATCCTGCTGGATGCATGTGTGGGAGAGGGGTGCCCTG
GGTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATAACTTAAAAATCAT
GCTCAATAGGATTACACTGAGGCCCAGTCTAGGTGAGAGTTTTGGAAGAGGATGCTGGGA
TCCCAGGGTCCCCAGGAGGGCCCCTGTATTTTTGGCTGGAGACCTAGAGGCCCTGAAGGG
CATCTTGGGGGTGCCCAAGCCTGTCTCTGTGCTCCTCCTTGAGGCAGCCCAGGCTCCCTG
TGCAGGCTTGGTGTTGGCCCTCCAGTTCCCCGGGGTTGAGGCACATCGGAAGCTCCTTTC
TGAGCCCCATTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCCACATGGAGGACCCCTGGCA
TTGACTGGCATAGGTGAGTGGCTGGCGTCATGGGCCATGAGTCAGGCCGCGTGGGGTCGC
CAAGGGTCAGCCTTCGGGAAAGAAGGGTTTCCTCAGGGAGCCAACCTGAATCCCCACTGG
GAAGAGATGGGTTCTCCAGGAGGGCGACTTCCTGAGAAACAAGAACCATGGAGGACACCT
TCCCTGAAGCCCTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGGGTTCCTTCAGTTCCAC
CCAGGGCAGCTCCCAGCTGAGACTCGTGGCTTGCGTCTGGACTTAAGGACTGCCCTGGCC
GTATGAGGGGCACCACAGGGGCTCCGGGGTACCATGGGGTCACACAGGCACTGTCTGTCC
GTGGAGAAAGGTGGGTGATCGGGCCCATGGAGTTGAGCTGTTGAGATTCAAGGTTCGCAG
CTGACACATGGCCCTGACAGGGACCCACCCTGTTGAGAAATGGGCCATCCCATGGGCCTC
TTCAAGCCTGAAGTGGGGCGGTGCTCTTTCACTGGGTTTAGGTCAAGGCTGAGCTCTGGC
TGGTGCCTGGTGGTGCTGCAGTCCAGCCCTTGGACTCGTGAGCTTTGGGCCAAGAGGGCA
GCCCGTGTCCCACTGAAAGTCACCCCTTTCCTGTGGCTGGAAGTTATCCCTTCCTCATGG
GCGAGTGTTGGGAAGGGTGGCCTCCTGAAGTGGGAAGGCCCGCTATTGAGGGTCTGCTCC
TGGAAATTTGCTGCCCTTGCTGCTTCTGAGCCATGGAGTCACCACCAGTGTGGTGGGGTC
TTGGGCCCGGAGAAAGGAGAAGACACTGTGCCCCCCAATTAGCCGAGTGTGGCCAGGCTG
TGTGTTTGTGGGGTGTGAGGGGCATGGATGGAGACTCAACAGAGAAAGCACGTGGCCCTG
GGGCCCCAGGTTGTGATTTCCAGTATGTGCTTGGATACAGCACATGGGTGGGTGCCCACC
ATGCACAGGGACTGGCTATGTGACTGCCAGCTCTGCAGCAGCATGAGGCATATGGGCCAG
CCTCCTTGGTTGACCATGAACTGGTTGCTGGCCCTGGCCTGTGCCCAGTAGTCCTGGGGT
GACCCTGGTGTCATGCAGGGGAGCTGGCATGTGTAGTGGAGGCGCTCGTGTGGTCTGCAG
TAGGGAGCAGCCCTGGCTTCTAGCCTGAGCCCAGTGACCTGCCTGTGCTGTCCTTTCAGG
GTTCAGTGGTGGAGAGAGCATCAGGTGCCCCACGTCTGTGATGGGCCAGTATTCCACATG
GATCTCATCACATGGGTCCATGGAAGGCGAGCATCCCTGAGCTGGCACACCACATCTTCT
GCCGGCGTGGAGGGGTGAGGTTGTGTTTGGCACCTGTCCTTTTCCTGTTCCTCAAGATGG
TGACCCCAGAGGAGGACTTGCATTGGGCCCACTGTCCCCGGGCCAGTGGCCATCAGCCAG
GTGCCTAGCCCCTGTTGCACTGAAGCTCGGGCCCTTCCTGTTGCTCTGGTCTCCTGCATT
GAGCTTGGGTGAGCCCATCCGGGTGCCACTGGATGCCTAAGCAGGGAGGGGGGTTCCCTG
GGTTGGGTCGATGATGAGAACCTTATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCA
TGCTCAATAGGATTACGCTGAGGCCCAGTCTAGGTGAGAATTTTGGAAGAGGACGCTGGG
ATACCTAGGTCCCTGACAGGGCCACTATATTTTGAGCTGGAGACCTGGGTCCTTGAAGGG
CATCTGGAGGGGGCCCAAACCTGTCTCTACGTTCCTCCATGAGGCAGTCCAGGCTCCCTG
TGCGAGCTTCGTGTCAGTGCTCAGATTCCCCTGGGTGGTGCATGTGGGTGGCTCATCCCT
GAGCCCCTGTTCTCCCCTTGTGTCTTTCAGTGAACTCTTTCACCCAGGAGGACCCCTGGC
CTTGAGCGGCACAGGTGAGTGGATCCTGCTGGGGTCATGGGCCATGGACCAGGCCACTTG
GGGTCACTGAGGGTCAGCTTTCAGGACAGGAGGGATTCCTCAGGGAGACAACCTGAATCC
CCACTGGTGAGGGATTGGTTCTCCAGGAGGGCCGCCTCCTTGGGAATCTGGCCCAAGGAG
GACACCTTCCCTGAAGCGCTGTTGGAGTGACATTGGTCCAGGCAGGAAAGGGTTCCATTA
GTCCCATGTAGGTCAGCTCCCAGCTGAGACTTGGTGCTAGGGTCTGGCCTTGAGGACTGC
CCAAGCCAGATGAGGGTGTTCTCAGGCTGTGATTTTTGGTGCGTGCTTGGAGAGGGAGTC
TGGGCACCCTCGCCGCACAGGGGCAGGCTGTGCGTCTGCCAGGTCTGCAGTAGCGCCTAG
CTTCAGAGCAAGCCTCCTTGGTTGGCCTGAGCTGGTTGGTGGCCCTGGCTCCTACCCAGG
GGTCACAATGCAGCCCAGGAAGTGCAGGGAAGCTGGCTTGGACAGTGGAGGTGCTCCAGG
GGCCTGCGGTAGGGCACAGCCTGGGCATCTTGCCTGAGCCTAGTTACTCGCCTGTCCTGT
CCTTCCAGGGTTTGATGGTGGGGAGGTACAAGGGTTCCCCGGGTCCATAACTGTCCCCAT
TTCACATGGATCCCATCACATGAGTCCATGGACGTACAGCATGTGTAGCCAGCAGCCCCT
CCCCCCTTTCCTGCATGGAATCTTAAGGCCCTGTTTGGACACCTTTCCCCTGTCCCTCCA
GATGGTGAGCACAGAGGAAGAATTGCATTGGGCCCTTTGGCCCCGGACCAGTGTCTGTCA
GCCACGTGCTCAGCCTCCCGTGCGCTAAAGCTCAGGTCCTTGCTGTCATCCTGGTCTCCT
GCACTGAGGTGTGCTGAGCCCATCCAGGTCCCTCTGGATGTGTGAGTGGGGACGGGGGTG
TCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGGGGTGATGACTTAAA
AATCATGCTTAATAGGATTACGCTGAGGCCCAACTTAGGTGAGAATTTTGGAAGAGGATG
CTGGGAATCACAAGGTCCCCGGCAGGACCACTGTATTTTAGGGTGGAGACCTCAGGGCCC
TGAAGGGCATATCATGGAGGGGTACCCAACCCTGTCTGTGCTCCTCCATTATGCACACCA
GGCTTCCTGTATGGGCTTGGTGTCCACACTCCGCTTCCCCGGGGGTGAGACACGTTGGCT
CCTTCCTGAGTCGCATTCTCCTCTGTGTCTTTCGTGAGCTCTTCCCCCCCCAGCAGACCC
CCTAGGATTGACTGGCATAGGTGAGTGGATACTGCTGGTGTCATGGGCCATGAGCCAAGC
TGCGTGGGGTCCCCGAGGGTCAGCCCTTGGGCCACGTGGGTTTCCTCAGGAGCTGATCTG
AATCCCGACTGGGGATGTGTTCTCCAGGAGGGCAGCTTCCTTTGGAATCGGACACAAGGA
GGAGGCCTTCTCTGAAGCCCTGCAGGGGTGGTGGTGGTCCAGGCAGGAAAGGGTTTCCTC
AGCTCTATGCAGGACAGTGGAGCTGGGCAGTGCTCAGCTCACACTTGGTGCTCAGGTCAG
GCCTCTAGGATGGCCAGGCCACATGACGGGGGCCACAAGGGCTCTGGGGCACCACGGGCA
TCTCACAGGGGCTCTCCAACTCTGGAGAAGAGTGGGCAATTTGGCCCGTTGGGTCGGGCC
ACGGAGTTACAAGGATCGCACCAAACCCATGTCCCTCAATGGGACCGACCCTATTAAGCA
ATGGGCCATCCCAGTGGCACCTCTTTGAGCCATGTGGTGGGCGGCGCTGTTTCTCTGAGG
TTGGGTCAAAACTAGCTCCGGCCAGTGCCTGATGGTGGTGCAGTCCAGTCCTGGGACTCG
TGGGCTTTGGGCCAAGGGTGCAGCCTGTGTCCCACTGGGGATTCCCCCTTCCTTATGAGG
GAGTGGTGGGAAGGGTATCCTCCTGAGGTAGGAAGGCCCCCTGTGGAAGGAACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATTTCCAGTGCACCTTGGGAAGGGGCCTGGGTGCTCGCCCTCCATGCCACTTGG
GGAGGCTGTGCAGCTGCCAGGTTGGCAGTGGCACATGACGTCCGGGCCAGCATCCTTGGT
TCGCTGTGAGCTGGTTGGTGTCCTTGACCCCTGCCCAGGGGTCCCGGTGCTGCCCGGGGT
CGGGCAGCACACTGGACTGGAGAGCCAGTGTGGGCAAAGGAGGCCTGCAGTAGGGCACAG
CCCGGGCGTCTTGCCTGAGCCCAGGAACCTGCCGGCCCTGTCCTTCCATGGTTCAGTGGC
TGGGAGGGCAAAGGGTCCCTCACGTCTGAGACACATCAGTGTTTCACATGGATCTCATCA
CGTGGGTCCATAGAGAGAGAACAAGCGTGAGCTGGCACCCCCCACCCCCTTCCCTGTATG
GAGGCCTGAGCCCCTGGTTGGACACATGTCCTCCTCCCGTCCCCCCAGATGGTGTCTGTG
GAGGAAGACTTGCCTTTGGGTTGCTGGCCCCAGGCCAGTGGTTGTCATCCAGGTGCCCAG
CCTTGGTGCACTGAAGCTCAGGTCCTTCCTGGTGCCCTGGTTGCCTGCACTGAGCTGTGG
TGAGCACATCTGTGTGCGGTGGGGGGCACCCTGGGTTGGGTCGATGATGAGAACCATATA
TTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGACCA
GCCTAGGTGAAAATTTTGGAAGAGGACTCTGGGATCCCATGGTCCCCAGCAGGGCCACGG
TATTTTGGACTGGAGACCTGGAGGCCCTGAATGGCATCTCAGGGATGACCAACCCTCTCT
CTGTGCTCGTCCTTGAGGCAGCCCAGGCTCCCTGTGCAGGCTTGGTGTCAGCCCTCCAGT
TCCCCGGGGGCATCACATGTTGGAGGCTCCTTCCTGAGCCCCCGTTCTTCCCTGTGTCTT
TCAGTGAACTCTTCTGCCCAGGCGAGCCCCTGGCCTTGAGCAGGATAGGTAAGTGGATCC
TGCTGGGGTCATGGGCCATGAGCCAGGCAGCTTTGGATCACTGAGGGTCATCCTTCAGGC
CAAGAGGGATTCCTCAGGGACCCAACCTGGAACCACCAGGGACAGGTGGTTTCTCCAGGA
GGGCGGCTTCCTTGGAAATCTGTCCTAAGAAGGACGTGTTCTCTGAAGCCATGCAGAAAT
GATGGAGGTCCAGGCAGGAAAGGGTTCCTTCAGCCCAATGCAGTGCATGTCCTAGCTGAG
ACTCATTGCATGAGTCAGGCCTGGAGCACTGCCCAGGCCACATGACGAGGTCCACAGTAT
CTCCGAGAGCCACAGGTGTTATGCAGGAGCTCTTGGTCCCTGAGGCTTGTTAGTGGGGTA
GGGTGAGGGTGATCGGGCTTATGGAGTCAGGCTGTGAAGATTCAAGGATCGGGCCCAACC
CATGGCCCAGAATGGACCAACCCTGTGGAGCAATGGGCCATCCCAGTGGTGCCTCCTTGA
GCCTGGTGGGGGCGGTGTGGCCTCAGTGGGTTTGGGTCAAGGCTGAGCTCTGGCCTTCAC
CTGGTGGTGCCGCAGGCTGGCCCTGGGAATTGTAGGCCTTAGGCCAAGGGTGCAGCCTGC
ATCCCGCTAAAGGTCACCCCTCCCTGAAGTGGAGTGGCCAGAAGGGTGGGATTGTGTTGT
GAAAGGCCCAATGTCAAGGGTCCTTTCCTGGCAATTTGCCACCCAGGCTGCTTCTGAGAC
ATGGGGTCATCTCCAAGGTGGCATGTTTTTCAGCCAAAGGAAAGGAGAGGGCATCACGTG
TCCCCTGATTGGCCGAGTGTGGCCTGGCTCTGTGTTTGGGAGGTGTGTGGTGCATGAATG
GGGACCCACCAGAGAAGGCACATGGCCCTAGGGACCCAGGATGCGATTTCCTGTGTGAGC
TTATAGAGGTCACCTAGATTGGTGCATTCCATGCCCAGGGGCAGGCTATGTGACTGCCAG
ATCTGCAGTGGCACATGGCATCCAGACCAGCCTCCTTGGTTTGCCGTGAGCTGGTTGGTG
GCCCTGACTGGTGCCCAGTGGTCCTGGTGCGGCTCTGGGGTCATGCAGAGGAGCTGATGT
TGGCAGGGGAGGTGCTCTCCGGGCCTGCCATAGGGTGTGGCCCACCGTAGGAGCAGCCCG
GGGGTTCTTGCCTGAGCGCATTGACCCACCTGCCCTGTCCTTCCAGGGTTCGGTGATGGG
GAGGGTCAAGGGTCCCCCGCATTCGTGATGAGTCAGTGTTCCCCATGGATCCCATCACAT
AGGTCCATGGAGGGCGAGGATGGGTGAGCCGGCACCCCATGCACGCTTCCCTGCATGGAG
GGGTGAGGCCCTGTTTGGACCCATATCTTCCACCTGTCCCCTCAGATGGTGAGCCCCGAG
GAAGAATTGCTTTGGGCCTCCTGGCCCCGGGCCAGTGTCCGTCAGCCAGGTGCCCAGCCC
CTGGTGCACTGAAGCTCAGGCCCTCCTGGTGCCCTGGTCTTCTGCACTGAGCTGTGGTGA
GCCCATCTGTGTTCCTGTAATGCCTGTGTGGGGAGGGGTTGCCCTGGGTTGGGTCGATGA
TGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATT
ACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAGGAGGATGCTGGGAATTACCCAGCAGG
ACCATTGTATTTTGGGCTAGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGGCCAACC
CTGTCTCTGCGCTCCTCCGTGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTCGGCGC
TCCTGTTACCCAAGGGTGGGGCACTTTGGCGTCTCCTCCCTGAGCCGCCATTCTCCCCTG
TGTCTTTCAGTGAGCTCTTCTGTCCAGCAGACCCCCTGGCATTGACCAGCATAGGTGAGT
GAATCCTGGTGGCGTCATGGGTGATGAGTCAGACTGCGTTGGGTCACCAAGTATCAGTCT
TCAGGCAGGAGGGTACCCTCAGGGAGTCGAACTGAATTTCCACCGTGAAGAGATGGGTTC
ATCCTCCAGGAGGGTGGCTTCCTGGGGAATCAGACCCAAGACGACGCCTTCCCTGAAGCC
TTGCAGGGATGATGGTGGTCCTGTCTGGAAAGGGTTTCTCACACAGGGCAGCTCCCAGCT
GACACTCGGTGCACGAGTCTGTCCTCGAAGACTGCCCAGGACAAATGAGCAGGACAACAG
GGGCTCCAGGGTGGCACAGGGATCACGCGCGGGCTCTCCCTCCCCAGAAAGGGGTGGGTG
ATCGGGCCCATGGGGTCAGGCTGTGGAGATTCAAGGATTGCGCCCCACTCATGGCCCTGA
ATGCGAATGACCCTGTAGAGCAATGGGCCACCCCAGTAGCTCCTCCTTGAGCCTGGTGGG
TGACAGCTCAGCTTCAACTGGTTGGGTCAAGGATGAGCTTCGTGGTGCTGCAGGCCAGCC
CTGGGACTCATGGGCTTTGGGTTAAGGGTGCAGCCCGCCTGCTGCTGGGGGTCACCCCTT
CTTCGAGGTCAGTGGCGGGAAGGGTCACGTCCCGAGGTTGGAAGTCCCCCTCATGAGGGA
CCTGTTCCAGGAATTTGTTGCCCAGGCTGCTCCTGAGCCATGGGGTTACCTCCAGGGTGG
CAGGGTCTTGGGCTGAAAGAAAGGAGAGGGCACCGTGTGGCTCCTGATTCGCCAAGTGTG
GCCCAGCTCTGTGTTTGACAGGGGTCTGGGGTGTGGATGAGGACCCACCAGAGAAAGCAC
GTGGCCGCGGGCCCCAGGCTGTGATTTCTGGTGTGTGCTTAGAGAGGGAGCCTGGGCGGG
TGTCCTCCCCATACAAGGGCAGGCTGTGGGACTGCCAGGTTGGCAGCAGTGCCTGGCATC
CGGGCCAGCCTCGTTGGTTGGCCTGAGCTGGTTGGTGACCTTGGACCTTGCCCAGGGATT
CTGTTGTTGTCCAGAGTTGTGCAGTGGAGCCAGCATGGGCAGTGGAGATGCTGCAGGGGC
CTGCTATATGGCACAGCCCAGGCATCTTGCCCAAACCCAGTGACTCGCCTACCCTGTCCT
TTGAGGGTTTGGTGGCGGAGAAGGCCAAGGGTTCCCTGGGTTCATGACTGTCATTATTTC
ATGTAGATCCCATCACATGGATCCATGGAGGGAGAGCATGTGTGAGCCAGCACCCCCTCT
TTGCTTTCCCGCACAAAGGCGTGAAGCCTTGTTTGAACACCTGTCCCCTGTCCCTCCAGA
TGGTGACCCCAGAGGAAGACTTGCGTTGTGCCCACTGGCCCCAGGCCAGTGGCCGTCAGA
CAGTTGCCCAGCCCCTGGTGAGCTGAAGCTCAGGCCCTACTGGCACCCTGGTCTCCTGCA
TTGAGCTTGGTGAGCACATCCAGGTCCTGCTGGATACATGTGTGGATAGGGGGCACCTTG
GGTTGGGTCGATGATGAGAACCTTATATTGTCTGAAGAGAGGTGATGACTTAAAAATCAT
GCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGA
ATTACGAGTTCCCTGTGAAGCCCACTGTATTTTGAGCTAGAGACCTGGAGGCTCTGAGGG
CATCTGGAGGGTGCCCAACCCTGTCTCTGTGCTCCTCCGTGAGGCAGCCCAGGCTCACTA
TGTGGGCTTGGTGTCAGCGTTCTTGTTACCCAAGGGTGGGGCACTTTGGCATCTCCTCCC
TGAGCCCCCATTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCGGCAGACCCCCTGAC
ATTGACCAGCATAGGTGAGTGGATCCTGCTGGGGTCATGGGTCATGAGCCAGGCTGTGTG
GGGTTGCCGAGCATCAGCCTTCGGCTGCAAGGATTTCCTCAGGAGCTGACCTGAATGCCC
ACCTGGGATGGGTTCTCCAGGAGGGCAGCTTCCTTAGGAATCGGACCCAATGAGGATACC
TTCCGTGAAGCCCTGCAGGGGTTGCAGTGGTCCAGGCAGTAAAGGGTTTCTTCAGCCCCA
TGCAGGGCAGCACCCAGCTGAGACTCGGTGCTCAAGTCAGGCCTCTAGGATGGCCAGGCC
ACATGAGGGGGACCACAAGGGCACTGGGGCGCCAAGGGGGTCTTATGGGGGCTCTCTGAC
CTTGGAGAGGTATGTGTGATTCGACCCATGAAGTCAGGCTTTGGATTTTCAAGGATCTCT
CCAAACCCATGGCCCTGAATGGGACCAACCCTATTAAGCTATGGGCCATCCCAGTGGTGC
CTCTTTGAGCCAAGTGTGAGATGGCGCTGTTTCCATGAGGTTGGATCAAGACTAGCTCTG
GTGACCCCATGATGATGGTGCTGCAGTCTGGCCATGGGACTCGTGGGCTTTGGGCCAAGG
GTATAGCCCATGTCCCACCGGAGGCCACACCTTCCTTGTGGGCAAGTGGCAGGCAGGGTG
TCCTCCTGAGGTAAGAAGGCCTGCTGTGGAAGGACCTGTCCAGGCTGCTTCTGAGCTACG
GGGTCACCTACAGGGTGGCGGGGTCAAGGAAAGGAGAAGACACCATGTGTCCCCCAGTTG
GCTGAGTGTGGCCCCACTGTGTGTGTGGGAGGTGTTGTGTGAGGCATGGATGGGGACATA
TCAGAGAACACACGAGGCCCTGGGTCCCCAGGCTGCGATTTCCAGTGTGGTGTGGAGCAG
GGCCTGGGTGCTAACCCTCCACACAGAGGGGCAGGCAGTAGTGGTACGTGGCATCCAGAC
CAGCCTCCTTGGTTGGCCATGAGATGGTAGGTGGCCCTGGCCCGCACCCAGGGGGCTGGT
ACAGCCCTGGGGTCATGTGAAGCAACTGGAGTGGGCAGTGGAGGTGCTCAAGGTGCCTGC
AGTAGGGCATAACCAGGGCATCTTGCCTGAGCCCAGTGACATACCTGCCCTGTTCTTCCA
GGGTTCAGTGGTGGGGAGGGCCAGGGTTCCCCCATGTCCCTGACACGTCAGTGTTTCACA
TGGATCCCATCACATGGGTCCATGGTGGGAGAGCAATCGTGAGCTGGCATCCCCCACCCC
CTTCCCGCATGGAGGCGTGAGGTTCCATCTGGACACATGTCCACCTCCTGTCCCCCAGAT
GGTGAGACTGGAAGAAAACTTTCATTGGGCCTGCTGTCCCAGGGTGAGTGGTCATCAGCC
AGGTGCCCAGCCCTTGGTGTGGTGAAGCTCAGGCTCTTCCTGGCACCCTGGTCTCCTGCA
CTGAGCTGTGGTGAGCACATCTGGGTCCCGATGGATGCATGCGTGGGGATCGGGGGGGTG
CCCTGAGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAAAGAGGTGATGACTTAAA
AATCATGCTCAATAGGATTACGCTGAGGCCCAGCTTAGGTGAGAATTCTGGAAGAGGACA
CTGGGATCCCGAGGTCCCCTGGCAGGGCCACTGTATTTTGGGCTGGAGTCCTTGAGGCCC
TGAAGGACATCTTCAGGGTGCCCAACCCTGCCTCTGCACTCCTCTGTGTGGCAGCCCAGG
CTCCTTGTGCAGGCTTGGTGTTGGCACTCTGGTTCCCTGGGGGCGGGGCACATTGGCAGC
TCCTCCCTGAGCCCCCGTTCTCCTCTGTGTCTTTCAGTGAGCTCTTCTACCCAGGCAGGC
CCCTGGCCTTGAGCAGCATAGGTGAGTGGATCTTGCTGGGGTCACGGGCCAAGAGCCAGG
CCACAGGGGGTCGCTGAGGGTCACCCTTCAGGCAATGAGGGTTTCCTTAGGGAGCTGACC
TGAATCCCCACCAGAGATGGATGGTTTCTCCAGGAGGGCGGCTTCCTTGGTAATTGATCC
CAAGAAGGACCCATTCCCTGAAACCCTGCAGGGGTAATGGAGGTCCAGGCAGCAGAGAGT
TCCTTCAACCCAATGCAGTGCAGCAACTTGTTGCCTTGATGCTCCCCATACCTGGAGAAA
GGTGAGCATAGGGCCCATGGAGTTGAGTTGCAGAGATTTAAGGATCGCACAGGACTTATT
GCCCTAAATGGGACTGACTCTGTTGAGCAATGTGCCATCCCATGGTACCTCTTTGGGCAC
TTGGTGCATGGGTCAGGCCTGGAGCACTGCCCAGGCCACATGAGGGGTCCGCTGGGTCTC
CGGGGGCCATGGGTGTTATGCAGGAGCTCTCTGTCCCCAAGGCTTGCAGGGGGGTAGGGT
GTGGGTGATCGAGCTTATGGAGTCAGGCCGTGAAGATTCAAGGATTGGGCCCAACCCATG
GCCCTGCTGGGACCGACCTTGTTGAGCAATGGGCTATCCCACTGGTGCCTCCTTGAGCCT
GGTGGAAGCGGTGTGGCCTCAATGGGTTTGGGTCAAGGCTGAGCTCTGGTCAGCAGCTGA
TGTTTGGCCCTGGGAATCGTGGGCTTTGGGCCAAGGGTGCAGCCTGTGTCCCACTGGAGG
TCACCCCTACCAGAAGTGGAGTGGATGGAAGGGTGTCATCCTGTGGTGGAAGACCCACTG
TAAAGGGTCCTGTCCTGGCAATTTGATGCCTAGGCTACTTCTGAGCCATGGAGTCACCTC
CAGGGTGGCGGGGTCTTGAGCCAAAGGAAAGGAGAGGACATCATGTGGCCTCTGATTGGC
CGAGTGTGGCCCAGCTCTGTGTTTGGGAGGTGGGTGGTGCATGAATGGGGACCCACCAGA
GAAGGCATGTGGCCCTAGGGCCCCAGATGTGATTTCTGGTGTGTGCTTATAGAGGGTGCC
TGGATGGGTTCATTTAATGCCCAGGGGCAGGCCATGTGACTGCCAGGTCTGCAGTGGTAC
GTGGCATCCAGGCCAGCCTCCTTGATTTGCTGTGAGCTGGTTGGTGCCCGTGGCCCTGCC
CAGTGGTCCGGATGCAGCCCAGATTCGAGCAGGGGATTTGGCGTGGGCAGTGGAGGTGCT
CCGGGGTCCTGCACTAGGGTGCAGCCTGGGCGTTTTGCTCGAACCCTGTGACCTGCCTGC
CCTGTCCTTCCAGGGTTCAGTGGCCAAGGGTTCCTCGCGTGCATGACCGTCACTGTTTTA
CATGGATCTCATCTCATGGATCCATGGAGAGAGACCATGTGTGAACCAGCACCCCCTGCC
GACTTTCCTGCATGGAGGCATGAAGCCTTGTTTGGACACCTGTCCCCTACCCCTCCAGAT
GCTGACCCCAGAGGAAGACTTGCGTTGGGCCTGCTGGCTCTGGGCTCAGCCCCTGGTGAG
CTGAAGCTCAGGCCCTTCCTGGCACCCTGGTCTGCTGCACCGAGCTGCGGTGAGCCTATC
TGGGTACCACTGGATGCATGGGTGGCGGGGTGGTGGGGGGTGATGCCCTGGGTTGGGTCG
ATGATGAGAACCTTATATTGTCTTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAG
GATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAAGATGCTGGGATCCAGAGTT
CCCTGGAATGGCCAGTGTATTTTGGGCTGGAGACCTTGAGGCCCTGAACAGCATCTTGTG
GGGGCCCAACCCCTTCTCTGTGCTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGTGGGCTT
GGTGTTACTGCTCCGGTTCTATGAACCCCCATTCTCCCCTTGTGTCTTTCAGTGAGCTCT
TCCACCCAGGTGCGACTTCCACCCTGGCATTGACCAGCATAGGTGAGTGGTCCTGCTGGG
GTCATGGGTCATCAATCAGGCAGTGTGGGGTCACTGAGGGTCAGCTTTTGAGACAGGAGG
GTTTCCACAGGCAGCCGACCTGAATCCACACCATGGAGGGGTGGGTTGGTCCTCCAAGAG
GGCTGTTTTTTTGGGAATCAGACCCAAGGAGGATACCTTTCCTGCAGCCCTGCAGGGATG
ATGGTGGCCCAGGCTGGAAAAGTTTCCTTCAATCTCATGCAGGGCAGTTCCCAGCTGAGT
CTCAGTGCACTGGTTTGGCCTCGAGGACTGACCAGGCCACGTGAAGGGGGCCACAGGGGC
TTTGGGATGCCATGGGGTCACACAGGAGCTCCCCATCCCTGGAGAAAGGTGGGCATAGAG
CCCATGGAGTTGAGCTGCAGATATTTAAGGATCACACAGGATTTATTGCCCTGAATGGGA
TCGACCCTGTTGAGCAATGTGCCATCCCATGGTACCTCTTTGGGCCTGGATGGGGCAGTG
CTGTTTCCCTAGGTTTGGGTCAAGTCTGAGCTCTGGCCAGTGCCTGGTGGTGCTACAGTC
CAGCCACGGACTCGTTAGCTTTAGGCCAAGGGATCAGCCCACGTCCTGCTGGATATCTCC
CCTTCCCTGTGGCTGGAAGTCACCCCTTCCCCATTGGCAAGTGTCAGGAAGGGTGGTCTC
CTGAGGTGGAAGGCCTGCTGTCAAGGGTCTTGTCCCTGGAATATGCCGCCCACGCTGCTT
CTGAGCCATAGGGTCACCTCCAAGGTAGCAGGTCTTGGGCCCAAGGAAAGGAGAAGTCAC
CATGTGTCCCCCAATTAGCCAAGTGTGGTCCTGCTCTGTGTTTAGGAGGTGTGTGGGGCA
TGGATGGGGACCCACCAGAGAAAGCATGTGGCCCTGGGGACCCCAGGTTGTAATTTCCAG
TTCATGCTGGGATAGGGCACCTGGATGGGTGCCCACAATGCACAGGGGCAGGCTATGTGA
CTGCCGGCTTTGCAGCGGCATCTCGCATCTGGGCCGGCCTCCTTGGTTGGCCATGAACTG
GTTGGTGGCCCTGGCCTGTGCCCAGTAGCTCTGTCGTGATCCTGGGGTCATGCGGGGGAG
CCAGCATGGGCAGTGGAGGTGCTCATGGGACCTGCAGTAGGACACAACCAGGTCTTCTTG
CCCGAGCCCAGTGACCCGCCTGCCCTGTCCTTCCAGGGTTCAGTGGTTGAGAGAGTACAG
GGTGCCTTGTGTCTGTGACAAGCCAGTGTTCTGCATGGATCTCATCACGTGGATCTATGG
AGGGCGAGCATCCCTTAGCTGCCACACCCCACCTTCTGCCTCCATGGAGGGGTGAGGTTG
TCTTTGGACACCTGTCCTACTCCTGTTTCCCCAGGTATTGAGCCTGGGGGAAGATATGAA
TTGGTCCCAATGGCCCCAGGCCAGCATCCATCAGCTAGGTGCCCAGCCCCTGGTGCACTG
AAGATTGGGCACTTCCTGGCACCCTGGTGTGCTGCACTGAGCTGTGGTGAGCACATCCGG
GTCCTACTGGAGGCATGCTCTGGGAAGGGGTGCCCTGAGTTGGGTCGATGATGAGAACCT
TATATTGTCCTGAAGAGAGTTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCTAGTCTAGGTGAGAGTTTTGGAAGAGGATGCTGGGATCCTGAGGTCCCCTGGTAGGGC
CATTGTATTTTGGGCTGGAGACCTGGAAGCCCTGAAGGGCATCTGGGAGGCCCAACCCTG
TCTCTGTGCTCCTTCATAAGGCAGCCCTGGCTTCCCGTGTAGGCTTGGTGATGGCCCTCC
TGTTCCCTGGGGGCAGGGCACATGGGCAGCTCCTCTCTGACCCCCATTCTCTCCTGTGTC
TTTCAGTGAGCTCTTCCCCCCAGGTGGGCCCCCTGGCATGGACCAGCATGGGTGAGTGGA
TCCTGCTGAGGTCGTGGGCCATGCACCAGGCTGCATGGGGTCACCAAGTATTAGCCTTCA
GGACAGGAGGGTTTCCTCAGGGAGTCGACCTTATTCCCCACCTGTGGAGAGATGGGTTTG
TCCTCTAGGAGGGCAGCTTCCTGGGGAATCAGACCCAAGACGATGCCTTCCCTGAAGCCC
TGCAGGGGTGACAGTGGTCCAGTCTGGAAAGGGTTCCTTCAGTCTCATGCAGGGCAGCTC
CCAGCTGACACTTGGTGTGAGAGTCTATCCTCGAGGACTGCCCAGGACAAATGAGTGAGA
CAACAGAGGCTCCCGGATGCCACAGGGAACACTCAGGGGCTCTCTGTCCCTGGAAATGGG
TGGGCAATCGGGCCCATGGGGTGGGGCTTTGGAGATTCAAGGATCATGCCCCGCTCATGG
CCCTGAATGTGAATGACCCTGTTGAGCAATGGGTCACACCAGTAGCTCCTTGAGCCTGGT
GGGTGACGGCTCGGCTTCAACTGGTTGGGTCAAGGCTGAGCCATGACTGGTGCTTCATGG
TGCTGCAGGCCAACCCTGGGACTCATGGGCTTTGGGTCAAGGGTGCAGCCCGCCTGCTGC
TGGGGGTCACCCCTTCTTCGAGGTCAGTGGCGGGAAGGGTCACGTCCCGAGGTTGGAAGA
CCCCCTCATGAGGGACCTGTCCCGGGAATTTGTTGCCCAGGCTGCTTCTGAGCCCTGTGG
TCACTTCCAGGGTGGCGGGGTCTTGGGCCCAAGGAAAGCAGCGGCACCATGTGGCTCCTG
ATTGGCTCAGTGTGGCCCAGCTCTGTGTTTGACAGGGGTCTGGGGTGTGGATGAGGACCC
ACCAGACAAAGCATGTGGCCCTGGGACCAGGCTGTGATTTCTGGTGCATGCTTGGAGAAG
GATCCTGGGCAGGCGTTCTCCCCATACAGGGGCAGGCTGTGGGACTGCCAGGTCAGCAGC
AGTGCCTGGCATCCAGGCCAGCCTCGTTGGTTGGCTGTGAGCTGGTTGGTGGCCTTGGAC
CCTGCCCAGGGTTTCCGTTGTGGTCCAGACTCATGCAGTGGAGCCAGTGTGAGCAGTGGA
GGTGCTCCAGGGGCCTGCTGTATGGCACAGCCAGGGCATCTTACCCAAGCCCTCCTGGTG
CCGTGGTCTCCTGCACTGAGCTGTGGTGAGCCCATCCGGGTTCCTGTGATGCCTGTGCGG
GGAGGGGGTTGCCTTGGGTTGGGTCGATGATGAGAAACTTATATTGTCTGAAGAGAGGTG
ATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTG
GAAGAGGATGCTGGGAATTACGAGTTCCCTGTGAAGTCCACTGTATTTTGAGCTAGAGAC
CTGGAGGCTCTGAGGGCATCTAGAGGGTGCCCAACCCTGTCTCTGTGCTCCTCCGTGAGG
CAGCCCAGGCTTACTGTGTGGGCTTGGTATAGGCACTCCTGTTACCCGGGGGTGGGGCAC
TTTGGTGGCTCCTTCCTCAGCCCCCATTATTCCATGTGTCTTTCTGTGAGCTCTTCTGTC
CAGCAGACCCCCGGCATTGACCAGCATAGGTGAGTGGATCCTGCTGGGGTCATGGCCCAT
GAGCCAGGCTGTGTGGAATCGCCAGGCATCAGCCTTCGGCTGCAAGAGTTTTCTCAGGAG
CTGTCTTGAATCCCCACTTGGAATGGGTTCTCCAGGAGGGCGGCTTCCTTGGGAATCAGA
CCTAAGGAGGATACCTTCCCTGAAGCCCTGCAGGGGTTGCGGTGGTCCAGACAGTAAAGG
GTTTCCTCAGCCCCATGCAGGGCAGTGCCCTGCTAAGACTCAGTGCTCAGGTGAGGCCTC
TAGGATGGCCAGGCCACATGCAGGTGGCCACAAGGGCTCCGGGGTGCCAAGGGGGTCTTG
CAGGGGCTCTCTGACCTTGGAGAGGTGTGTGTGATTCAGCCCATGGGGTCGGGCCTCAGA
TTTGCAAGGATCTCTCCAAACCCATGGCCCTGAACGGGACTGACCCTATTAAGCTATGGG
CCATCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTGCG
GTCCAGGCTGCTTCTGAGCCGTGGGGTCACCTCTAGGGGGGCAGGATCTTGGGCCCAAGG
AAAGGAGAAGACACCATGTGTGCCCTGATTGGCTGAGTTTGGCCCTGCTCTGTGTGGAAG
GTGTTGTGTGGGCATGGATGGGGACCCACCAGAGAACACATGAGGCCCTGGGACCCCAGG
CTGTGACTTCCCGTATGGTGTGGAGTGGGGCCTGGGTGCTTCCCCTCCACACACAGGGGC
AGGCTGTGCGACTGCCAGATCGGCAGCAGTTCATGGCATCCGGGTCAGCCTCCTTGGTTG
GCTGTGAGAGAGTAGGTGGCCCTGGCCCACACCCAAGGGGCTGGTACAGTCCTGGAATTA
TGAGAGGCAGGGGATGTGGGCAGTGGAGATGCTCAAGGTGCCTGCAGTAGGGCATAACCA
GGGCATCTTGCCTGAGCCCAGTGACCCACCTGCCCTGTCCTTCCAGGGTTCAGTGGTGGG
GAGGGCCAGGATTCCCCCATGTCCATGACACATCAGTGTTTCACATGGATCCCATCACAT
GGGTCCATGGTGGGAGAGCAATCGTGAGCTGGCATCCTCCAGCCCCTTCCTGCATGGATG
AGTGAGGTTCCATTTGGACACATGTCCACCTCCTGTCCCCCAGATGGTGAGACTGGAAGA
AAACTTTCATTGGGCTCGCTGTCCCGGGGCGAGTGGTCATCAGTCAGGTGACAGCCCTTG
GTGTGGTGAAGCTCAGGCTCTTCCTATTGTCCTGGTCTCCTGCACTGAGCTGTGGTGAGC
ACATCGGGGTCCCACTGGATGCATGTGTGTGGAGGGGGGTGCCTTGAGTTGGGTCAGTGA
TGAGAACTTTTTACTGTCCTGAAAAGAGGTGATGACTTGAAAATCATGCTCAATAGGATT
ACGCTAAGGCCGAGCCTAGGTGAGAATTTTGGAAGAGGACACTGGGATCCCAAGGTCCCC
TGGCAGGGCCACTGTATTTTGGGCTGGAGTTTTTGAGGCCCTGAAGGGCACTTTGGGGGT
GCCCAACCCTGTCTCTGCGCTCCTCTGTGTGGCAGCCCAGGCTCCTCATGCGGGCTTGGT
GTTGGCACTCTGGCTCCCAGGGGCTGGGGCAGGTTGGCAGCTCCTCCCTGAGCCCCTGTT
CTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGGCCCCTGGCCTTGAGCAGCAT
AGGTGAGTGGATCCTGCTGGAGTCATGGCTCATGAGCCAGGCCACGGAGGGGTGCTGAGG
GTCACCCTTCAGGCCACGAGACTTTCTTCAGGGAGCCGAACCTAAATCCCCACCAGGGAC
AGATAGTTTCTCCAGGAGGGCAGCTTCCTTGGAAATCAATCCCAAGAAGGATGCCTTCCC
TGAAGCCCTGCAGGGGTAATGGAGGTCTAGGCAGGAGAGGGTTCCTTCAACCTAACACAG
TGCAGATCCTAGCTGAGACTTGGTGCACAGGTCAGGCCTGGAGCACTGCCCAGGCCATAT
GAGGGGGTCTGCTGGGTCTCCGAGGGCCATGAGTCTTATATGCAAGCTCTTCTTCCCCGA
GGGCTTGCAGAGGGGTTGGGTGTGGGTGATCAGGCTTACGGAGTCAGCCGTGAAGAATCA
AGGGTTGGGCCACACCCATGGCCCTGAATGGGGGCAGACCCTGTTGAGCAATGGCCATCC
CAGTGGTGCTTCCTTGAGACTGGTGGGGGTGGTGCTGCCTCAATGGGGTTGGGTCAAGGT
TGAGCTCTGGCTGGCACCTGGTGGTTGGTCCTGGGCATCATGGGAATTGGGCCAAGGGTG
CAGCCTGCGTCCCGCTGGAGGTCACCCCTCCCCAAAAAGGGGTGGCTGGAAGGGTGGCAT
CCTGTGGTGGAAGGCCCACTGTCAAGGGACCTGTGCTGGCAATTTGCTGCCCAGGCTGCT
TCTGAGACATGGGGTCACCTCCAGGGTGGCAGGGTCTTGAGCCAAAGGAAAAGAGAAGAT
ATCATGTGTCCCCTGACTGGCTGAGTGTGGCCTGGCTCTGTGTTTGGCAGGTGCATGATG
CATGAATGGGGACCCACCATTTGAATGGACATGGCCCTGGGGCCCCAGGATGTGATTTCT
GGTGTAGGCTTGTAGAGGGCACCTGGACAGGTGCATTTCAAAGCTAGGGGCAGGCTATGT
GCCTGCCAGTTCTTCAGTTGTCTATCAGTAGCGTCCAGGCCAGACTTCNNNNNNNNNNGG
GAGAGCATCTGTGAGTCAGCACACCCTGCGCACTTTATGGAGGAGCTGAGGCCGTGTTTG
GACACCTGTCCCCCAAAAAGCCGGAAGGTGACCCAGGAAGAAGAATTGCTTTGGGCCCAC
TTGTCCCCGGGCCAGTGTCCCTCAGCCAGTGCTCAACCCCTGGTGAGCTGAAGCTCAGGC
CCTTCCTAGTGCCCTGGTCTCCTAAACAGAGCTGTGGTGAGCCCATCTACGTTCCAGTGG
ATGCATGCATGGTATGGGGGGTGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTACATT
GTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAAGCCCAGC
CTAGGTGAGAATTTTGGAAGAGGATGCTGGGATTTTAAGGTTCCTGGCAGGGCCACTGTG
TTTTGGACTGAAAACCTCCAGGCCCTGAACAGCATCTCACAGGGGGGCTCTACCCTGTCT
CTGCATTTCTATGTGAGGCAGCCCAGGCTCCCTTTGTGGGCTTGGTGTTGGCGCTCTGGT
TCCCCGGGGTAGGGCACCTTGCTGGGTCCTTCCTGAGCCACCATTCTCCCCTTGTGTCTT
CTGTCTTTCAGTGAGCTCTTCGGCCCAGGTGGGCCCCCTGACATTGATGCGCATAGGTGA
GTGCATTCTGCTGGCATTATGGGCCATGAGTCAGGCCGCGTGGTGTCACTGATGGTCAGC
CCTCAGGAAAGAAGGGTTTCCTCAGGGAGCCGACCTGAATCCCCACTGAGGAGGGATGGT
TTCTCCAGGAGTCTGGCTTCCTTGGGAATCAGACCCAAGATGATGCCTTCCCTGAAGTCC
TGCAGGGGTGACAGTGGTCCAGGCAGGAAAGGGTCCCCTCAGTCCCATGTAGGGCAGCTC
CCAGCTGAGACTCGGTGTTTGGGTCTGGCCTCAAGGATGGCCCAGGCCACATGAGGGGGG
TCACAGGGACTCTGGGGTGCCACAGGGGTCACACGAGAGCTCTCTTTCCCTGGAGAGGGG
TGCTTGAATGGGCCCATGTGGTCAGGCCATGGAGATTTCAAGGATCGCACCCCAACCATG
GCCTTAAATGGGACCGACCCTGTTGAGTAATGGGCCAGCTCAATGGTGCCTTTTTGAGCT
TGGTCGGGGACGGTGCTGTTTCCCTGGGTTTGGGTCAAGACTGAGCTCTGGCCAGCACCT
GGTGATGCTGCAGGCTGGCCCTTGAACTTGTGGGCTTTGGTCCAAGTCGGCAGCCCACGT
CTTACTGGAAGTTACCCTTTGCATGTTGGTGAGTGGCTGGAAGAGTGGATTCTGAAGTGG
GAAGACCCGCTGTCGATGGTCCTGTCCCGGGAATTTGCCACCCAGGCCTTTTCTGAGCCA
TGGGGTCACCTCCAGCATGGTCAGAGTCTTGGGCCTATGGAAAGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTGGAGTCACTGAGCGTCAGCCTTCAGGACAGGAGGGTTTCCTCAGGGAGCACACT
TGAATGCCCACCAGGGATGGAAGGGTTGATTCTCAAGAAGAGTGGCTTCCTGGGAAATTG
GACCCAAGGAGGATGCCTTCCCTGTCCTTTCAAGGACTGGTGGCTGAGAGATCACAGGGT
GCCCTGCGTCTGTGACAGGCCAGTGTTCCACATGGAGCCCATCACATGGGTCCATGGAGG
GCGAGCATCCCTGAGCCACCACACCCCACCTTCTGTCTCCATGGAGGGGTGAGGTTGTGT
TTGGATGCCTGTCCTACTCCTGTTTCCCCAGATGTTGAGCCTTGAGGAAGACTTGCATTG
GACCCAATGGCCCCAGGCCAGCGTCTGTCAGCCAGGGTCCCCCTGGTGCACTGAAGATGG
GGCTCTTCCTGGTGCCCTCGTCTCCTGCATTGAGCTGTGGTGAGCACATCCAGGTCCCAC
TAGATGCATGCGTGGGCAGGGGAGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATATT
GTCTGAAGAGAGGTGCTGACTTAAAAGTCATGCTCAAAAGGATTATGCTGAGGCCTGGCC
TAGGTTAGGATTTTGGAAGACGATGCTGGAGTTATGACTTCCCCAGCAGGACTACTGTAT
TTTGGGCTAGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAACCCTGTCTCTGC
ACTCCTCTGTGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTTGGCGCTCCTGTTACC
CGGGGGTGGGGCACTTTGGCAGCTCCTTTCTGAGCCCCCAATCTCCCCTGTGTCTTTCAG
TGAGCTCTTCTGCCCAGCAGCCTTCCTGGCAGTGACCAGCATAGGTGAGTGGATCCTGCT
GGGGTCATGGCCTATGAGCCAGGCTGTGTGGGGTCACCAAGCATCAGCCTTCAGCCACAA
GAGTTTCCTCAGGAGCTGACCCGAATGCCCACCTGGGATGAGTTCTCCAGAAGGGTGGCT
TCCTTGGAAATCATACCCAAGGAAGATACCTTCCCTGAAGCCCTGCAGGGGTTGCGGTGG
TCCAGGCAGTAAAGGGTTTTCTCAACCTCATGCAGGGCAGTGCCCCACTGAGACTCAGTG
CTCAGGTCAGGCCTCTAGGATGGCCAGGCCACATGAGGGGGGCCACAAGGGCTCTGGGGC
ACCAAGGGGTTCTTGCAGGGGCTCTCCAACATTGGAGAGATGTGTGTGATTCAGCCCATG
AGGTCAGGCCGCGGATTTTCAAGGATTGCACCAAACCCATGGCCCTGAATGGGACAAACC
CTAATAAGCTATGGGCCATCCCAGTGGTGCCTCTTTGAGCCAAGTGTGGGGTGGCGCTGT
TTCCTAAGGGTGAGTCGAGACTAGCTCTGGCCGGCACCTGATGGTGGTGCAATCCCGCCC
TGGGATTGGTGGGCTTAAGGACATGGGTACAGCCCATGTCCCATTGGGGTCACCCCTTCA
TTGTGGACAGGTGGCAGGAAGCGTGTCCTCCTGAGGTGGGAAGGCCTGCTGTGGAAGACC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGACTCTACCCTGTCTCC
ACATTACATGTGAGGCAGCCCAGGCTCCCTTTGTGGGTTTGGTGTCTGCACTCTGGTTCC
CTGTGGTAGGGCAGCTTGCTGGGTCCTTCCTGAGCCCCCATTCTCCCCTTGTGTCTTCTG
TCTTTCAGTGAGCTCTTCAGCCCAGGTGGGCTCCCTGACATTGATGCGCATAGGTGAGTG
CATTCTGCTGGCATCATGGGCCATGAGCCAGGCTGCGTAGGGTCACCAAAGGTCACTCTT
TAGGCCACGTGGGTTTCCTCAGGGAGCCGACCTGAATCCCCACCAGGTTGGGACAGTTTC
TCCAGGAGGCTGGCTTCCTTGGGAATCAGACTCAAGACGATGCCTTCCCTGAAGCCTTAC
AGGGGTAACAGTCGTCCAGGCAGGAAAGGGTCCCCTCAGTCCCATGGAGGGCAGCTCTCA
GCTGAGACTCAGTGTGTGAGTCTGGCCTCAAGGATGGCCCAGGCCACATGAAGGGGGCCA
CAGGGGCTCTGGGGTACCACAGGGGACATACGAGAGCTCTCTTTCCCTGGAGTGGGGTGC
TTGAATGAGCCCGTGGGGTTAGGCTGCAGAGATTCAAGAATCGCATCCCAACTGTGGCCC
TAAATGTGACTGACCATGTTGAGTAATGGGCCATCTCAGTGGGGCCTCTTTGAGCCTGGT
GGGGGGCGGGGCTGTTTCCCTGGGTTTGGGTCAAGGCTGAGCTCTGGCCAGCCCTGTCCT
GCTGGAGGTCACCACTTGCCTTCTGGTGAGTGGCTGGATCCTGAGGTGGGAAGACCTGCT
GTTGATGGTCCTGTCCCAGGAATTTACCACCCAGGCTGCTTCTGAGCCATGGGGTCACCT
CCAGGGTGGCGGAGTCTTGGGGCTAAGGAAAGAGAGGACACTATGTAGCCCACGGTTGAC
CAAGGGTGGCCTGACTCTGTGTTTGGGACATGTGCGGGACATGGATAGGGACCAGCCAGA
GAAAGCACGTGGCCCTGGGACTCTAGGCTGCGATTTCAGGTGTGGCTTGCAAATAGCACC
TAGGCAGGTGCCCACCATGCCCTAGGGCAGACTATGCAACTTCCATCTCCACAGTGGCAC
ATGGCTTCTGGGCCACTCTCCTTGGTTGGCCATGACTTGATTGGTTCCCCTGGCCTGTGC
CCTGTGGTCCCGGAGTGGCTCTGGGATCATGTGGGGCAGCCAACGTGGGCAGTGGAGATG
CTATCAAGGCCTTCAGTAGGGTGCAGCCCAGGTTTCTTGCCTGAACCCAGTGACCCACCT
ACCCTGTTTTTTCAGGGTTTGGTGACGGGGAAGGCCAAGCATGCCCCACATCCATGCTAG
GTCAGTGTTCCTCATGGACCCCATCACATGGATATCCCTTACCCCTTCCCCACATGGAAG
CATGAGGCTCTGTTTGGACACATGGCCTCTTCCTGTCCCCCACGATGGTGAGCCTGGAGG
AAGACTTGCATTGGGCCCAATGGACCCAGGCCAGTGGCCATCAGCCAGGTGCCCACCCTG
GTGTGCTGAAGCTCAGGACCTACCTGTTGTCCTGGTTTCCTACACTGAGCTGTGGTGAGC
ACATCTGGGTCCCTCTGGATGCATGCATGGGGCAGGGGGTGCCCTGGTTTGGGTCGATGA
TGAGAACCTTATATTATCCTGAAGAGAGGTGATGACTTAAAATTCATGCTCAATAGGATT
ACGCTGAGGCCCAACCTAGGTGAGAATTTGGAAGAGGATTCTGGGATCCCAAAGTCCCCA
GTAGGGGACTTTATTTATTTTGGGCCAGAGCCCTGGAGGCTCTAAAGGGCATCTGGGGGG
TCCAACCCTGTCTCTGTGCTCTTCCGTGAGGCAGCCCAGGCTCCCTGTGTGGGCTTGCTG
TTGGTGGTCCAGTTCCCTGGGGCGGGGCACGTGGACAGCTCCTCCTTGAGTCCCCCTTCT
CCACTTGTGTCTTTCAGCGAGCTCTTCAACCCAGGCGGGGCACTCTGGCATTCACCGGCA
TAGGTGAGTGATCCTGCTGCCATCATGGGCAGCCGGGTGAGTCACTGAGGATCAGCCTTC
AGACAGGAGAAGTTTCCCTCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTGCTGTTCACTAGGTTTGGGTCAAGGCTGGGCTCTGGCCAGTGCCTGGTGGTGC
TGAGGTCTGGCCATGGACTCATCGGCTTTGGGCCAAGGGGTCAGCCTGCTCCCCCTGGAA
GTCCTCCCTTACCCATGGCTGGAAGTCATCCCTTCCCAATGGGCAAGTGTCGGGAATGGT
TGCCTCCTGAGGTTGCAAGGCCTGCTGTCTAGTGTCTTGTCCTTGGAATATGCTGCCCAT
GCTGCTTCTGAGTCATGGGGTCACCTCCAGGGTAGCGGATCTTGGGCCCAAGGACAGGAG
AAGATGCCGTGTGTCCCGTGATTAGCTGATTCTAGCCCTGCTCTGTGTTCAGGAGGTTGC
ATGGATACATGCATCCTCCTGATGCACATGGATGCAGACCCACCAGAGAAAACTGTGGCC
CTTGGACCCCAGGTTGAGATTTCCAATATGTGCTGGGATGGGGCATCTGGGTGGGTGCCC
ACCATGCACAGGGATAGGCTATGTGACTGCCAGGGCTGTAGCGGCATCTGATCTCTAGGT
CAGCTTCCTTGGTTTCCTATGAACGAGTTGGTGGCTCTGGCCTGTGCCTAGTAGTCCTGG
GGTGACCCTGGGGTTGTGTGGGGGAACCAGCAGGGGCCCAGTGACCAGCCTGCCCTGTCC
TTCCAGAGTTCTGTGGCTAAGAGAGCACTGGGTACCCTGTGTCCGTGATGGGCCAGTGTT
CCTCATGCAAACGATAACATGGGTCCATGGAGGGTGAGTATACTTGAACTGCTACACCCC
ACCTTCTGCTCACATACAGGAGTCAGGTTGTGTTTGGACAGCTGTCCTACTCCTGTTCCC
CCAGATCGTGAAATGGGAGGAAGAATTGTGTTCGGCCTAATGGCCCTGGGACAGTGTCCG
TCAGCCTGGCATCCAGCCCCTGGTGTGCTGAAGCTCAGGCCCTTCCTGGTGCCCTAGTCT
CCTGCACTGAGCTTGGTGAGCCCATTCGGGTACTGCTGGATGCATTGGTGGGGAGGGAGG
TGCCCTGAGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTA
AAAATCATTCTCAAAAGGATTATGCTAAGGCCCGGCCTAGGTAAGAATTAGGGAAGAGGA
TGCTGGGATCCCGAGGACCCCAGGAGGGCCCCTGTATTTTTGGCTGGAGAACTGGAGACC
CTGAAGGGTATCTGGGGGGCCCAACCCTGTCCCTATACTCCTCTGGGAGGCAGCCCAGGC
TCTCTGTGCGGGCTTGGTGTTGACACTCTGGTTTTCTGGGGGCGGGTCAGGTTGGTGGTT
CCTTCCTGAACCCTTATTCTCCCCTTGATTCTTTCAGTGAGCTCTTCGGCTCTGGCGGGT
CCCCTGGGATTGATCAGCATAGGTGAGTGGATCTTGCTGGGTTCATGGGCCATGAGCCAG
ACACATGGGGTCACTGCGGGTCAGCCTTCGGGATAGGAAGATTTCCTCCGGGAGCCAACC
TGAATCCTCACCGTGGAGGGATGGGTTGGTCCCCCAGGAAGGTGGCTTCCTGCAGAATCT
GACCCCAGGAGGACACCTTCACTGAAGCCCTGCAGGGGTGATGGTGGTCCAGGCTGGAAA
GGTTTCCTTCAGTGTCATGCAGGGAAGCTCCCTGCTGACATTCAGTGCCTGCATCTGACC
TCAAGGACCGCCCGGGCCACATGAGTGGGGCAACAAGGGCTCCAGGGTGTCACGGGGATT
ATGAGGGGGGCTCTCCATCCCCGGAGAGAGGTGGGCGATCAGGCCCATGGGGTCAGGTTT
GTAGGGTTCGGTGGCACAGAAAGCCAAGGGTTCCTTGGGTCCATTACCATCACTATTTCA
CATGGATCCCATCACATGGGTCCACGGAGGGAGGACATGTGTGAGCAGGCACCCCTTGCT
CCCTTTCCCACATGGAGATATGAGGCCCTGTTTGGACACCTGACCCCCGTCCCTCCAGAT
AGTGAACCTGGAGGAAGACTCTTCTTGGGTCCCCTGGCCCCAAGCCAATGTCCATCAGCC
AGATGCCAGACCCCGGTGCACTGAAGCTCATGCCCTTCCTGGCGCCCTGGTCTCCTGCAC
TGAGCTGTGGTGAGAACATCCGGGTCCTGCTGGATGCATGCATGGGGAGGAATGTGCTCT
GGATTGGGCCAATGATGAGAACCTTATATTGTCCTGAAGAAAGGTGATGACTTAAAAATC
ATGCTCAATAGGATTACGCTGAGGCCCACCCTACGTGACAATTTTGGAATAGGACACTGG
GAATCAATGAGGAGCCTGGCAGGGCCCCTGTATTTTGGGGTGGAGACCTAGAAGGCCTGA
AGGGCACCTCGTGGGGGCCCAACGCTGTCTCTTCACTCCCCCGTGAGGCAGCCCAAGCTC
CCTGTGTGGGCTTGGTGTCGGCGCTCTGCTTTCCTGGAGGCGGGGCATTTTGGCTGCTCC
TTCCTAAGCCCCTGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTTCGCCCAGCAGACTCCC
TAGCATTGACCGGCATAGGTGAGTGTCTCCTGCTTGGGTCATGGGCCATGAGCCAGGCCA
TAGGATTGCCGAGGGTGAGCATTTGAGCCATGAGTGTTTCCTCAGGGGTCGACTTGAATC
CCCACCTGGGAAGTGTTCTCCAGGAGGGCAGCTTCCTTGTGAATCTGAGCCAAGTAAGAT
GCCTTCTCTGAAGCCCTGCAAGGGTGCCAGTTGTGCAGGCAAGAAAGGGTTCCCTCAGCC
CCAGGCAGGGCAGTGCCCAGCAGAGACTCAGTGGTTGGGTTAGGCGTCTAGGATGGCCAG
GCCACATGAGGGGGGCCACAAGGGCTCTGGGGCACCACAGGGTCTTCTCAGGGTCTCTCT
GACCCCTAAGAGTGGCGGGCGATTTGGCCCATGGGGTCGGGCCCTAGATTCAAGGATCAC
ACCACACCCATGGCCCTGAAGGGAAACGACCCTGTTAAGCATTGGGGCACCCCAGGGGTG
CCACTTTGAACCAGGTGTGGGGTGCCACTGTTTCCCTGAGGTTGGGTTGAGACTAGCTCC
GGCCAGCACCTGATGGTGGTGCAGTCCGGCCCTGAGATTTGTGGCCTTGGGCCCGGGGTG
CAGCCTGTGTCCCACTGGGGGTCACCCCTTCCTTGTGGGCGAGTGGTGGGAAGGGCATCC
TCCTGAGGTGGGAAGGCCTGCTGTGGAAGGGACTGTCCTGGAAATTTGCCATCCAGGCTG
CTTCTGAGCCATGGGGTCGCCTCCAGGTTGGCAGGGTCTTGGGCCCTAGGAAAGGAGAAG
ACACCGTGTTTCCCTCAGTTAGCTGAGTGTGGCCCTGCTCTGTGTGTGGGAGGTGTTGTA
TGGGGCATGGATAGGGACCCACCAGAGACAACGCATGGCCCTCGGTCCCCAGGCTGCAAT
TTCTCAGTGCATGCTTGGAGACGGTCCTGGGCCCCCTCCACACCCAGGGTCAGGCTGTGC
AACTGTCAGGTCGGCAGTGGCATGTGGTGTCTGGCCCAGTCTACTTGGTTGTCTGTGAGC
TGTTGGTGGCCCTGGCCCTTTCCCAGGGTTTCGGGTGCAGCCCTGGGGTCATGTGGGACA
GCCAGTGTGGGCAGTGGAGCTGCTCTGGGGACCTGCAGTAGGGTGCAGCCTGGGTGTCTT
GCCTGAGCCCAGTGACCTGCCTGCCGTGTCCTCACGGGGTTCGCTGGCAGGGAGGGCCAA
GGGTCCCCTGTGTCTGTGACACATCAGTGTTTCCCATGGATCCCAGCAAATGGGTCCACA
GAGGGAGAGCATGCGTGAACTGGCACCCTCCACCCCTCACCCTCTTCCCCACATGGAGGC
ATGAGCTCCTCGTTGGACACATGTCTGGGCCACATGAGCAGGGCAACAGGTGCTCCAGGG
TGTCATAGGGATTATGCAGGGGGCTCTCTGTCCCCGGAGAGAGGTGAGCAATCGGGCCCA
TGTGGTCAGGCTTGTAGGGTTCGGTGGTGGGGAGAGTCAAGGGTTCCCTGGGTTCATTAC
CGTCACTGTTTCACCTGGATCCCATCACATGGGTCCATGGAGGGAGCGCATGTGTGTGCA
GGCACCCCTTGCTCCCTTTCCCACATGAGCCCCTGGTTGGACACATGTCCTCCTTCTGTC
CCCCCAGATAGCGGCCCTGGAGGAGGACTTGTATTGGGGCCGCTGGTCCCACGTCAGTGT
CCGTCAGCCCGGCGTCCAGCCCCTGGTGTGCTGAAGCTCAGGCCCTTCCTGGTGCCCTAG
TGTCCTGCACTGAGCTTGGTGAGCCCATTCAGGTACTGCTGGATGCATAGGCGGGGAGGG
AGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGAC
TTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCCGGCCTAGGTTAGAATTTTGAAAGA
GGATGCTGGGATCCCGAGGTCCCCAGGAGGGCCCCTGTATTTTTGGCTGGGGACCTGGAG
ACCCTGAAGGGTATCTGAGGTGCCCAACCCTGTCCCTATACTCCTCTGTGAGGCAGCCCA
GGCTCTCTGTGCGGGCTTGGTGTTGACACTCTGGTTTTCTGGGGGCGGGTCAGGTTGGTG
GTTCCTTCCTGAACCCTTGTTCTCCCCGTGATTCTTTCAGTGAACTCTTCTGCTCAAGCG
GGTCCCTTGGCATTGACCAGCATAGGTGAGTGGATCCTGCTGGGTTCATGGGCCATGAGC
CAGAAACATGGGGTCACTGAGGGTCAGCCTTCAGGACAGGAAGATTTCCTCGGGGAGCCA
ACCTGAATCCCCACCATGGAGGGATGCGTTGGTCCTCCAGGAGGGTGGCTTCCTGGGGAA
TCTGACCCCAGGAGGACACCTTCACTGAAGCCCTGCAGGGTTGATGGTGGTCCAGGCTGG
AAAGGTTTCCTTCAGTGTCATGCGGGGCAGCTCCCTGGTAACATTCGGTGCCTACATCTG
AACTCGAGGACTGCGCGGGCCACATGAGCGGGGCAACAAGGGCTCCAGGGTGTCACGGGG
ATTATGAGGGGGGCTCTCCATCCCCATAGAGAGGTTGTCGATCGGGCCCATGGGGTCAGG
TTTGTAGGGTTAGGTGGCGGGGAGAGTCAAGGGTTCCCTGGGTCCATTACCGTCACTATT
TCACATGGATCCCATCACATGGGTCCATGGAGGGAGGACATGTGTGAGCAGGTACCCCTT
GCTCCCTTTCCCACATGGAGATGTGAGGTCCTTTTTGGACATCTGACCCCCGTCCCTCCA
GATAGTGAACCTGGAGGAAGACTCTTCTTGGGTCCCCTGGCCCCAAGCCAATGTCCATCA
GCCAGATGCCAGACCCCGGTGCACTGAAGCTCATGCCCTTCCTGGAGCCCTGGTCTCCTG
CACTGAGCTGTGGTGAGAACATCTGGGTCCCACTGGATGCATGCATGGGGAGGAATGTGC
TCTGGATTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAAAGGTGATGACTTAAAA
ATCGTGCTCAATAGGATTACGCTGAGGCCCACCCTACGTGACAATTTTGGAAAAGGACAC
TGGGAATCAATGAGGTCCCTGGCAGGGCCCCTGTATTTTGGGGTGGAGACCTAGAAGGCC
TGAAGGGCACCTTGTGGGGGCCCAACCCTGTCTCTTCACTCCCCCGTGAGGCAGCCCAAG
CTCCCTGTGTGGGCTTGGTGTCGGCGCTCTGCTTTCCTGGAGGCGGGGCATTTTGGCTGC
TCCTTCCTGAGCCCCTGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTTCACCCAGCAGACT
CCCTGGCATTGACCGGCATAGGTGAGGTCTCCTGCTTGGGTCATGGGCCATGAGCCAGGC
CATAGGGTTGCCGAGGGTGAGCATTTGAGCCATGAGTGTTTCCTCAGGGGCCAACCTGAA
TCCCCACCTGGGATGTGTTCTCCAAGAGGGCAGCTTCCTTGTGACTCTGACCCAAGTAGG
ATGCTTTCTCTGAAGCCCTGCAGGAGTGCCAGTTGTGCAGGCAAGAAAGGGTTCCCTCAG
CTGCAGGCAGGGCAGCGCCCAGCAGAGACTCAGTGGTTGGGTTAGGCCTCTAGGATGGCC
AGGCCACATGAGGGGGACCACAAGGGCTCTGGGGCACCACAGGGTCCTCGCAGGTCTCTC
AACCCCTAAGAGTGGCGGGAGATTCGGCCCATGGGGTCGGGCCCCAGATTCAAGGATCAC
ACCACACCCATGGCCCTGAAGGGAAACGACCCTGTTAAACATTGGGGCATCCCAGGGGCG
CCTGTTTGAACCAGGTGTGGGGTGGCGCTGTTTCCTTGAGGTTGGGTCGATACAAGCTCC
AGCCAGCACCTGATGGTGGTGCAGTCCGGCCCTGAGATTTGTGGCCTTGGGCCCAGGGTG
CAGCCTGTGTCCCGCTGGTGGTCACCCATTCCTTGTGGGCGAGTGGTAGAAAGGGCATCC
TCCTGAGGTGGGAAGGCCCACTGTGGAAGGAACTGTCCCGGAAATTTGCCGTCTAGGCTG
CTTCTGAACCATAGGGTCACCTACAGGTTGGCAGGGTCTTGGGCCCTAGGAAAGGAGAGG
TCACCGTGTTTCCCTCAGTTAGCTGAGTGTGGCCCTGCTCTGTGTGTGGGAGGTGTTGTG
TGGGGCATGGATAGAGACCCACCAGAGACAACGCATGGCCCTCGGTTCCCAGGCTGCAAT
TTCTCAGTGCATGCTTGGAGACAGTCCTGGGCCCCCTCCATGCCCAGGGTCAGGCTGTGC
AACTGTCAGGTCGGCAGTGGCACATGGTGTCTGGCCCAGTCTACTTGGTTTTCCATGAGT
TATTGGCCCTGGCCCTTTCCCAGGGTTTTGGGTGCAGCCCTGGGGTCATGTGGGACAGCC
AGTGTGGGCAGTGGAGCTGCTCTGGGGGCCTGCAGTAAGAAGGGTGCAGCCTGGGTGTCT
TGCCCGAGCCCAGTGACCTGCCTGCCATGTCCTCACAGGATTCCCTGGCATGGAGGGCCA
AGGGTCCCCTGTGTCTGTGACACATCAGTGTTTCCCATGGATCCCAGCAAATGGGTCCAC
AGAGGGAGAGCATGCGTCAACTGGCACCCCCCACCCCCGACCCTCTTCCCCACATGGAGG
CATGAGCCCTGGTTGGACACATGTCCTCCTCCTGTCCCCCCAGGTGGTGGCCCTGGAGGA
AGACTTGTACTGGGGCCGCTGGCCCCACGTCAGTGTCCGTCAGCCCGGCGTCCAGCCCCT
GGTGTGCTGAAGCTCAGGCCCTTCCTGGTGCCCTAGTGTCCTGCACTGAGCGTGGTGAGC
CCACAAGGGTACGGCTGGATGCATGGGCGGGGAGGGAGGTGCCCTGGGTTGGGTCGATGA
TGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAAGGATT
ATGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGAGATCCCAAGGTCCCC
AGGAGGGCCCATGTATTTTTGGCTGAATACCTGGTGGCCCTGAAGGGTATCTGTGGGGCC
CAACCCTGTCCCTGTGCTCCTCTGTGAGGCCACCCAGGCTCTTTGTGCGGGCTTGGTGTT
GACACTCTGGTTTTCTGGGGGCTGATCAGGTGGGTGGTTCCTTCCTGAACCCTTGTTCTC
CCCGTGATTCTTTCAGTGAGCTCTTCTGCTCAGGCGGGTCCCCTGGCATTGACCAGCATA
GGTGAGTGGATCCTGCTGGGTATCATGGGCCATGAGCCAGACACATGGGGTCACTGCGGG
TCAGCCTTTGGGATAGGAAGATTTCCTCCAGGAGGCAACCTGAATCCTCACCGTGGTGGG
ATGGGTTGGTCCTCCAGGAGGGTGGCTTTCTGGGGAATCTGACCCCAGGAGGACACCTTC
ACTGAAGCCCTACAGGGGTGATGGTGGTCCAGGCCGGAAAGTTTTCCTTCAGTGTCATGC
GGGGCAGCTCCCTGCTGACATTCAGTGCCTGCATCTGACCTCGAGGACCGCCCGGGCCAC
ATGAGCGGGGCAACAAGGGCTCCAGGCTGTCACGGGGATTATGAGGAGAGCTCTCTGTCC
TCGGAGAGAGGTGGGCGATCGGGCCCATGGGGTCAGGCTTGTAGGGTTCGGTGGCGGGGA
GAGTCAAGGGTTCCCTGGGTCCATTACCGTCACTATTTCACATGGATCACATCACATGGG
TCCATGGAGGGAGGACATGTGTGAGCAGGCACCCCTTGCTCCCTTTCCTGCATGGAGATA
TGAGGCCCTGTTTGGACACCTGACCCCCGTCCCTCCAGATAGTGAACCTGGAGGAAGACT
CTTCTTGGATCCCCTGGCCCCAAGCCAATGTCCATCAGCCAGATGCCAGACCCCGGTGCA
CTGAAGCTCATGCCCTTCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGAACATC
CGGGTCCCACTGGATGCATGCATGGGGAGGAATGTGCTCTGGATTGGGTCAATGATGAGA
ACCTTATATTGTCCTGAAGAAAGGTGATGACTTAATTCATGCTCAATAGGATTACGCTGA
GGCCCACCCTACGTGACAATTTTGGAAAAGGACACTGGGAATCAATGAGGTCCCTGGCAG
GGCCCCTGTATTTTGGGGTGGAGACCTAGAAGGCCTGAAGGGCACCTCGTGGGGGCCCAA
CCCTGTCTCTTCACTCCCCCGTGAGGCAGCCCAAGCTCCCTGTGTGGGCTTGGTGTCGGC
GCTCTGCTTTCCTGGAGGTGGGGCATTTTGGCTGCTCCTTCCTGAGCCCCTGTTCTCCCC
TGTGTCTTTCAGTGAGCTCTTTCACCCAGCAGACTCTCTGGCATTGACCGGCATAGGTGA
GTGTCTCCTGCTTGGGTCATGGGCCATGAGCCAGGCCATAGGGGTGCCGAGGGTGAGCAT
TTGAGCCATGAGTGTTTCCTCAGGGGCCGACTTGAATCCCCACCTGGGATGTGTTCTCCA
GGAGGGCAGCTTCCTTGTGAATCTGAGCCAAGTAAGATGCCTTCTCTGAAGCCCTGCAAG
GGTGCCAGTTGTGCAGGCAAGAAAGGGTTCCCTCAGCCCCAGGCAGGGCAGCGCCCAGCA
GAGACTCAGTGGTTGGGTTAGGCCTCTAGGATGGCCAGGCCACATGAGGGGGGCCACAAG
GGCTCTGGGGCACCACAGGGTCCTCGCAGGGTCTCTCCGACCCCTAAGAGTGGCGGGCGA
TTCAGCCCATGGGGTCGGGCCCCAGATTCAAGGATCACACCACACCCATGGCCCTGAAGG
GAAACAACCCTGTTAAGCATTGGGGCATCCCAGGGGTGCCACTTTGAACCAGGTGTGGGG
TGCCACTGTTTCCCTGAGGTTGGGTTGAGACTAGCTCCGGCCAGCACCTGATGGTGGTGC
AGTCCGGCCCTGAGATTTGTGGCCTTGGGCCCGGGGTGCAGCCTGTGTCCCACTGGGGGT
CGCCCCTTCCTTGTGGGCGAGTGGTGGGAAGGGCATTCTCCTGAGGTGGGAAGGCCCGCT
GTGGAAGGAACTGTCCTGGAAATTTGCCATCCAGGCTGCTTCTGAGCCATGGGGTCGCCT
CCAGGGTGGCAGGGTCTTGGGCCCTAGGAAAGGAGAAGACACCGTGTTTCCCTCAGTTAG
CTGAGTGTGGCCCTGCTCTGTGTGTGGGAGGTGTATGGGGCATGGATAGGGACCCACCAG
AGACAACGCATGGCCCTCGGTCCCCAGGCTGCAATTTCTCAGTGCATGCTTGGAGACGGT
CCTGGGCCCCCTCCACACCCAGGGTCAGGCTGTGCAACTGTCAGGTCGGCAGTGGCACGT
GGTGTCTGGCCCAGTCTACTTGGTTGTCTGTGAGCTATTGGTTGGCCCTGGCCCTTTCCC
AGGGTTTCGGGTGCAGCCCTGGGGTCATGTGGGACAGCCAGTGTGGGCAGTGGAGCTGCT
CTGGGGACCTGCAGTAGGGTGCAGCCTGGGTGTCTTGCCTGAGCCCAGTGACCCGCCTGC
CGTGTCCTCACGGGGTTCCCTGGCAGGGAGGGCCAAGGGTCCCCTGTGTCTGTGACACAT
CAGTGTTTCCCATGGATCCCAGCAAATGGGTCCACAGAGGGAGAGCATGCATGAACTGGC
ACCCTCCACCCCCCACCCTCTTCCCCACATGGAGGCATGAGCTCCTCGTTGGACACATGT
CCTCCTCCTGTCCCCCCAGATGGCGGCCCTGGAGGAGGACTTGTATTGGGGGCACTGACC
CCACGTCAGTGTCTGTCAGCCCGGCATCCAGCCCCTGGTGTGCTGAAGCCCAGGCCCTTC
CTGGTGCCCTAGTCTCCTGCACTGAGCTTGGTGAGCCCATTCGGGTACTGCTGGATGCAT
GGGTGGGGAGGGAGATGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAG
AGAGGTGATGACTTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCCAGCCTAGGTTAG
AATTTTGGAAGAGGATGCTGGGATCCTGAGGTCCCCAGGAGGGCCCCTGTATTTTTGACT
GGAGACCTGGAGACCCTGAAGGGTATCAGGGGTGCCCAACCCTGTCCCTATACTCCTCTG
TGAGGCAGCCCAGGCTCTCTGTGCGGGCTTGGTGTTGTCACTCTGGTTTTCTGGGGGCAG
GTCAGGTTGGTGGTTCCTTCCTGAACCCTTGTTCTCCCCGTGATTCTTTCAGTGAACTCT
TCTGCTCAAGCAGGTCCCCTGGCATTGACCAGCACAGGTGAGTGGATCCTGCTGGGTTCA
TCGGCCATGAGCCAGAAACATGAGGTCACTGAGGGTCAGCCTTCAGGACAGGAAGATTTC
CTCGGGGAGCCAACCTGAATCCCCACCGCGGAGGGATGCGTTGGTCCTCCAGGAGGGTGG
CTTCCTGGGGAATCTGACCCCATGAGGACACCTTCGCTGAAGCCCTGCAGGGGTTTTGGT
GGGCCAGGCCGGAAAGGTTTCCTTCAGTGTCATGTGGGGCAGCTCTCTGCTGACATTCAG
TGGGTGCGTCTGACCTCCAGGACTGTCTGGGCCACATGAGCAGGGCAACAGGTGCTCCAG
GGTGTCACAGGGATTATGCAGGGGGCTCTCTGTCCCCAGAGAGAGGTGGGCGATCGGACC
CATGTGGTCAGGCTTGTAGGGTTCGGTGGTGGGGAGAGTCAAGGGTTCCCTGGGTTCATT
ACCATCACTGTTTCACCTGGATCCCATCACATGGGTCCATGGAGGGAGCGCATGTGTGTG
CAGGCACCCCTTGCTCCCTTTTCCACATGAGCCCCTGGTTGGACACATGTCCTCCTTCTG
TTCCCCCAGATGGTGGCCCTGGAGTAGGACTTGTATTGGGGCTACTGGCCCCATGTCAGT
GTCCATCAGCCCGGAGTCCAGCCCCTGGTGTGCTGAAGCTCAGGCCCTTCCTGGTGCCCT
AGTCTCCTGCACTGAGCTTGGTGAGCCCATTCGGGTAGTGCTTGATGCATAGGCGGGGAG
GGCGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATG
ACTTAAAAATCATTCTCAAAAGGATTATTCTGAGGCCTGGCCTAGGTTAGAATTTTGGAA
GAGGATGCTCAGATCCCAAGATCCCCAGCCAGGCCACTCTATTTTTGGCTGGAGTCCTTG
AAGCCCTGAAGGGCGTCTGAGGGCTGCTGCAACCTGTCTCTGCGCTTGTCCGTGAGGCAA
TCCACTTTCACTGTGTGGGCTTGGTGTTGGCCTTCCCATTCTCTGGGAATGGGGCATATT
GTCCGCTTCTCTCTGAGTCCCCATTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAG
GTGGTCCCCCTGGTCTTAATGGGCATAGGTGAGTACATCCTGCTGGTGTCATGGTCCATG
AGCCAGGGTGCATAGGGTTGCCGGAGGTCACCTTTAGGCCATGTGGGTTTCCTCAGGGAG
CTGACCTCAATCCCCACTGGGGAGGGATGGTTTCTCCAGGAGGGTGTCTTCCATAGAAAC
TGGTTCCAAGAAGGATGCCTTCCCTGAAGCTGTGCAGGGGTGATGGTGGTCCAGGCAGGA
AAGGATCTCTTCAACCCAATGCAGTACAGCTTCTAGCTGAGACTTGGTGCACAGGTGAGG
GCTTGAGGACTCCCAGGCAACATGAGGGGTTCCACAGGATCTCCGGAGGTCACAGGTGTT
AACCAGGAACTCTCCATCCTTGAGGCTTTCTGGGGGTGGTGGGATGGTAGCAGGGTGTGG
GTGATCGAGTTTATGGATTCAGGCCAAGATTCAAGGGTCAGGCCCCACCCATTGCCCTGA
TGGAACCAACCCTGTTGAGCAATGGGCTATCCCATTGGTGCCTCCTTGAGCCTGGTGTGG
GCAGCGTGGCTTCAAAGGGGTTGGGTCAAGGCTGAGCTCTGTCCCACACCTGGTGGTTGG
CCCTGGGAATTGTGGACTTTGGGCCAAGGGTGCAGCCCGCCTGCCTCTGGAGGTCCTCCT
ACCCAGAGGTGGAGTGGCTGGAAGGGTGGCAGGCATCCTGTGGTGAAAGGCCCACTGTTG
AGGGTCCTGTCCCACCAATTTGCTGTCCAGGCTGCTTCTGAGCCATGGGTTCACCTCCAG
GGAGGCAGGATCTTGAGCCCAAGGAAAGGAGAGGACATCATGTGTCCCCTGATTGGCTAA
GAGTGGGGAGAGTGTTTGGGGGGTATGTGGTGCATGAATGGGGACCCACCAGAGAAGGCA
CATGGCCCTGGGGCCCCAGGAAGCGATTTCCAGCATGCTTATAGAGGGTGTCTGAGTGGA
CACTCTCCACGCCCAGGCGCAGGCTATGTGATTGCCAGGTCTGCAGCAGTTCGTGGCATC
CGGGCTAGCCTCCTTGATTGCTTATGAGCTGGTTGATAGCCCTGGCATGTGCTGAGGGGT
CCTGGTGCAGCCCTGGGGTTGTTTGGGGGAGCCAGCATGGGCAGTGGAGGTGCTCTTGGG
GCCTGCAGTAGGGCACAGCCCAGGTGTTCTTGCTTGAGCACAGTGAACCACCTGCCCTGT
CCTTCCAGGGTTCGGTAGCAGGGAGAGCCAAGGGTCCCCCATGTCCATGACAGGTCAGTG
TTCCTCATGGATCCCATCACATGGGTACATGGAGGGAGAGCATGTGTGAGCCAGCACTCC
CTGCTCTCTTCCCCGCATGGTAGGGTAAGGCCCTGTTTGGACCCATCCTCCACCTATCTC
ACCAGATGGTGAGCCCAGAGGAAGACCCCCTGGCTCTGGGCCAGTGTCCGTCAGCCAGGT
CCCTGGTCCCCAGTGCGCTGAAGCTCAGGCCCTTCCCAACACCCTGGTCTCCTGCACTGA
GCTGTGGTGAGCACATCCGGGTCCCACTGGATGCATGCGTGGGGAGGGGCATGCCCTGGG
TTGTGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTAATGACTTAAAAATCATG
CTCAATAGGATTATGCTGAGGCCCAGTCTAGGTTAAAATTTTGGAAGAGGACGCTGGGAN
NNNNNNNNNTGCTCCTCTGTTGAGGCAGCCCTGGCTCCCTGTGTGGGCTTGCCCCTTGGT
GCTCTGGTTCCCGGGTGGGGCATGTGGGCAGCTCCTTCCAGAGTCCCCATTCTCCCCTGT
GTCTTTCAGTGAACTCTTCTGCCCAGGTGGGCCCTCTGACATTGACCGGCATAGGTGAGT
GGATCCTGCTTGGGTCATGGGTCATGAGCGAGGCAAAGTGGGGCCACCATGCATCTACCT
TTGGGCCATGAGAGTTTCCTAAAAGTATGGACCTGAATTCCCACTGGGGATGAGTTATCC
AAAAGGGCCACTTCCTTGGGAATCGGACCCAAGGATGCCTATCCTGAAGCCCAGCAGGGG
TGATGGTGGTCCAGGCAGGAAAGGGTTCATTCAGCCCCATGCAGGCAGCTCCCATCTGAG
ACTCGGTGCATCAGTCAGGCCTTGAGGACGGCCCAGGACACATGAGGTGGCCGCAGGGAC
TCTGGGGTGCTATGGGGGGTCTGCAGAGAGGAGTAGACGATTGGGTCCATGGGGGTCATG
CCGCAGAGTTTCAAGGACTCTGGCCCTGAATGGGACTGACCCTGTTGAGCAATGGACCAT
CCCAATGGCACCTCCTTGAGTCTGGTGGTGGGTGGTGGTGTTTCCCTGGGGCTAGGTCAA
GGCTGAGCTCTGGCCAGTGCCAGTGGTGCTGCAGGCTGGCCCTAGAACTCATGGGCTTTG
GGCCATGGGGACAGCTTGGGTCATGCTTGGGGTCACCCCTTCCTGGAGGTTGAATGGCGG
GAGTGGTGGCTTCCTAAGATGGGAAGTCCCGCTGTTGAGCAACCTGTCCTGGGAATTTGC
CACCCGGGCTGCTTCTGAGCCATGAGGTCACCTCCAGGGTGGCAGCATCTTGGGTCCAAG
GAAAGGGGAGCATACCATGTGTCCCCACATTGGTTGAGTGTGGCCTGGCTCTGTGTTTGG
GAGGTGTGCAGGGCATGGATGGGGACCCATCAGAGAAAGTACGTAGCCCTGGAGCCCCAG
GCTGTGATTTCCAGTGTGTGCTTGGAGAGGGGCAGGAGCAGGCTCTTGACTGCCAAGTCT
GCAGCCACACGTGGCATCCGGGCCAGCCTCCTGGTTGGCCATGTGCTGGTTGGTGGCCCT
GGCCTGTGCCCAGTGGTCTCAGGGTGGACCTGGCATTGTGCAGGGCAGCCGGCAGGGCAG
TGGAGGTGCTCTCCGGACCTGCAGTAGGGCGCAGCCTGGACTTTTTGTGTGAGGCCAGTG
ACCCACCTGCCCTGTCCTTCCAGGGTTGGGTGGCTAGGAGGGCCAAGGGTGGTCCGTGTC
CGTCTCCATGATGCATCAGTGCTCTGCATGGATCCTATCACATGGATATCCCCTACCCAC
CTTCCCCACATGGAGGCATGAGGCCCTACTTGGACACGTGTCCTCCTATCCTAGATGGTG
AACTCAGAGGAAGACTTGCATTGGGCCCAGTGGACCTGGGCCAGTGTCTGTCAGCCAGGT
CCCCAGCTCCTGATGCACTGAAGTTCAGGCCCTTCCTGGAGCCCTGGTCTCCTGCCCTGA
GCTGTGGTGAGCCCATCTGGGTCCCACTGGATGCATGCATGGGAGGGAGTTACCCTCGGT
TGGGTCGATGATGACAACCTTATATTGTCTGAAGAGAGGTGATGACTTAAAAATCATGCT
CAATAGGATTACACTGAGGCCCAAACTAGGGGAGAAATTTAGAAGAGGACACTAGGATCC
TGAGGTCCCTGGCAGGGCCACTGTATTTTGGGCTGGAGACCTCAAGGCCCTGAAGGGCAT
CTTGGTGGCCCCCAGCTCTGTCTCTGCACTCCTCCATGAGGCAGCCCAGGCTCCCTGTGT
GGGCTTGGTGTCAGAGTCCCATTCCCCAGGGGTGGGGCAGGTTGGTGGCTCCTCCCTGAG
TCCCCTTTCTCTCTTGTGTCTTTGAGTAACCTCTTCTGCCCAGGTGGGCCCCCTGGCGTT
GACCAGCATAGGTGAGTGGAACCTGCTGGTGTCATGGGCCATGAGCCAGCCCATGTGGTG
ACTCCAGGTCAGCCTTCAGGACAGGAGGGTTTCCTCAGGGAGTAGGGGAGTCCCCACCGG
GAAGGGATGGGTTCTCCCAGAGGGCCACTTTCTTTCGAATTGGACCCATGGAGGACATCT
TCTCTGAAGACCTGCAGAAGTGATGATGTTTCAAGCAGCAAAGGGTTTTTTCAGCCCCTG
AAGAGCAGGCAGCTCCCAGATGAGATTCTGTGCATGGGTCAGGCCTTGAGAACTGCCCAG
GCCACACGCGGGGTGCCACACAGGCTGTGAGGCACCACAGGGGTCTTGCAGGAGCTCTCG
GTCTTCAGGCTTGTTGTGGGGGTGGTGACAGAGTGATCAGGCCCACAGGGTCAGGCCGCA
GTGTTTCAAGGATCGCGCCCACCCGTGGCCCTGAATGGGACCGATGCTGTTGAGCAATGA
GCCATCCCAGTGGCTCCACATTGAGCCTGGTGGGGGCACCACTGTTTCAGTGGGGATGGG
TCAAGCTTGAGCTCTGGCCAGCACCTGATGGTGTTGCAGGCTGGCCCAGGGACTTGTGGG
CTTTGGGCCGGGTCGGCAGCCTGAGTTCTGCTGGGGGTCACATCTTTCCTGAGTGCCAGT
GTCAGGATGCATGGCCTCCTTAGGTGGGAAGGCCTGCTGTGGAGGGTCCTTTCCTGGGAG
TTTGCTGCCCAGGCTGCTTCTGAGCCATGGCGTCACCTCCAGGTGGTGGGGTCTTGGGCC
CAAGGAGCAGAGGAGACACCATGTGGCCCCTGATTTGTCAAGCATGGCCTGGCTCTGAGT
TTGGGAGGTGTGCAGGGCATGGATGGGGACCCACCAGAAAAAGCATGGGCCCATGGGGCC
CCAGGCTGCGATTTCTGATGTGCACTTGGAGAGGGCACCTGGTTGGGCGCCCACCATGCC
CAAAGGCAGGCTATGCAACTACCAGGTCTGCGGCAGTGCCTGGCATCAGGACCAGCCTCC
TTTGTTGGCCGTGAGCTGGTTGGTGGCCCTAGCCCATGTCCAGTGGTCTCTGTGCAGCCC
TGGGGTCATGTGGAGCAGCCAGTGTGGGCAGGGGAGGTTATCTTGAGGTGTGCATTAGGC
ATATCCCAGGCGTCTTGCCTGAGCCCAGTGACCTCCCTGCCCTGTCCTTCCAGGGTTTGG
TGGCAGGGAGGCCCAAGGGTACCCTGTGTCTGTGACAGGTCAGTATTTCATGTGAATCCC
ATCACATGGGCCCTCCTCCTGTCCCCCCAGATGGTGAGCCTGGAGGAAGACTTGCACTGG
GCCTGCTGTGCCCCAGCCAGAGGCCATCAGCCAGGTGGCCAGGTCCTGTTGTACTGAAGC
TTGGGCCCTTCCTGGTACCCTGGTCTCCTTCATGGAGCTGGTGAGCCCATCCGGGTTCTT
CTGGTTGTATGCATGGGGAGCAGGGTGCACTGGGTTGGGTCAATGATGAGAACCCTATAT
TGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGACCCAG
CCTAGGTGACAATTTTGGAAGTGGACACTGGGAATCATGAGGTCCCTGGCAGGGCCACTG
TATTTTGGGCTGGAGACCTGGAGGCGCTCAAGGGCCTCTCACAGGGACCCAACCCTGTCT
CTGTGCTCCTCCGTGAAGCACACGAGGCTCCCTGTGCGGACTTGGTGTTGGCACTGTTTC
CCGGGGGCAGGGCATGTTGGTGGCTTTTCCCTGAGTCCCTATTGTTGCCTTGTGTCTTTC
AGTGAGCTTTTCAGCTCAGAAGGGCCCCTTCACCTTGATTAGCATAGGTGAGTGCATCCT
GCTGCTGTCATGGGCCATGAGTCAGGCTGCGTGGGGTCACCGAGGGTCAGTCTTTAGGAC
AGGAGGGTTTCCTCAGGGAGCCAACCTGTATTTCCACCGGGGAGGGACGGTTTCTCCAGG
AGGGCGGCTTCCTTGGGAATTGGACCCAAGATGTTGCCTTCCTGAAGCCCTGCAGGGATG
ACAGTGGTCCAGGCAGGAAAGACTTCCTTCAGCCCCGTGCAGGAGAGCTCCCAGCTGAGA
CTCGGTGCATATGTCAGGCCTCGAGGACTGCCCAGGCCACATGACGGGGGCCACAGAGCC
TCCGGGGCACCACGGGGGTCATGCAAGGATTCTCTTTCCCTGGAGAGGGGTGCTTGAATG
AGCCCACGGGGTTGGGCTGTGGAGGTTCAAGGATTATACCCCAACCATGGCCCAAAATGG
CACTGACCCTGTTGAGCTATGGACCATCCCATGGCACCTCTTTGAGCTTGGCGGGGGGCA
GTGCTGTTTCCCTGGGTTTGGGTCAAGGCTGAGCTCTGGCCAGTGCCTGGTGGGGCTGTG
GGCTGGACCTGGGGCTCGTGGGCTTTAGGCCAAGTTGACAACCTGTGTCCTGCTGAAGGT
CACCCCTTCCCCATGGGTGAGTGGCTGGAAGAGTGGAATGTGTGGTGGGAAGGCCCGCTG
TTGATGGTCCTGTCCCGGGAATTTGCTGCCCAGACTCTTTCTGTGCCATGGGGTCATGTC
CAGGGTGGCAGGGTCTTGGGCCTAAGGAAAGGACACCATGTAGCCCAGGATTGGCCGAGG
GTGGCCCGGCTCTGTGTTTGGGACATGTGTGGGGCATGGATGGGGACCCACCAGAGAAAG
CACATGGCCTAGGTACTCCAGGCTGCAATTTCAGGTGTTGTTTGGAGAGAGTGCCTGGGC
AGGTGCCCACCATGCCCAGCGGCAGGCTATGCAACTTCCACGTCCACAGTGGCCAATGGC
TTCTGGGCCAGCCTCCTCAGTTGGCCATGAGCATGTCGGTGACCCTGTCCCATGCTCAGT
GGTCCCGGGGCAGCCCTGGGATCATGTGAAGGAGAAGCCAGAGGGGGCACTGGAGGTGCC
CTCAAGGTCTGCGATAGCATGAAGACCAGGGGTCTTGCCCAAGCCCAATGATCTGCCTGC
CCTGTTTTTTCAGGGTTTGGTGATGGGGAGGGCTGAGGGTGCCCTGTATCCGTGACAGGT
CAGTGTTCCACATGGATCCCATCACATGGGTATCCCTTACCCCGTTCCCCACCTGGAGGT
ATGAGGCCCTGTTTGGATACATGTCCTCCTCCTGTCCATCCAGATGGTGAGCCTGAAGGA
GGACTTGCATCAGGACCAATGGACCCTGGCAAGTGTCTGTCAGCCAGGTGCTCAGCCCCT
GGTGCACTGAAGCTCAGGCCCTTCCTGGCCCCCTGATCTCCTGCACTGAGCTGTGGTGAG
CACATCTGGGTCCCGCTGGATGCATGTGTGGGTGGGGGGGGGGTGCCCTGGGTTGGGTCA
ATGATGAGAACCCTATATTGTGTTGAAGAGAGGTGATGACTTAAAATTACCATGCTCAAT
GATTACGCTGAGGCCCAACCTAGGTGAGAAATTTGGAAGAGGATGCTGGGATCCCGAGAT
TTCCGGCAGGGCCACTGTATTTTGGGCTGGAGCCCTGGAGGCCCTGAAGGGTATCTGGAG
GAGGCCCAACTCTGTCTCTGCACTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGCGGGCTT
GGTGTTGGCCCTTCTGTTCCCCAGTGAAGTGGCACGTGGGTGGCTCCTCCCTGAGCCCCA
GTTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCTGCCAAGGGGGGGCCTCCTGGCATTGAC
CAACATAGGTGAGTGGATCCTGCTGGCATCATGGGCATGGGTTTGCCGAGGGTCAGACTT
CAGGCCATGAGGGTTTCCTCAGGGAGCTGACCCTAATTCCCATCAGGGAGAGATGGTTTC
TCCAGGAGGGCGGCTTCCTTGGGAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGT
GGTGGCGGGGTCGGCCACAGAGGTTCAAGGGTCTCATCCCACCTGTGGCCCTGAATGGGG
CTGATCCTGTTGAACAATGGGCCATCCCAGTGGCACGTATTGAGCCTGGTCAGGGGTGGT
GCAGTTTCAATGGGGTTGGGTCAAGGTTGAGATCTGGCCGGCTCCTGGTGGTGCTTCAGG
CCAGTCCTGTGACCCATGGACTTTGGGTTAAGGGGGTATCCCGTGTCCCATGGGGGTCAC
CTGTTCTCCATGTTTGAGTGGCGGTAACAGTGGCATTCTGAGGTGGGAAGGTCCACTGTC
TAGGGTCTTGTACCGGGAATTTGCTGCCCTGGCTTCTTCTGAGCCAAGGGGTCACCTCCA
GGGTCTCGGGATCTTGGGCCCTAGGAAACAAGAAGATACCATGTGGCCCTTGATTGGTTG
AGTGTGGCCCAGCTCTGTGTTTGGGAGGTGTGTGGGATATGGATGGGGTCCCACCAGTGA
AAGCTCATGGCCCAGGTCCCCAGGCTGTGATTTTCAGTGCACACTTGGGGAGGGCTCCTC
AGTGGGTGCCCACCACGCCCAGAGGCAGGCTATGTGACTGCCAGGTTTGCAATGGTGCAT
AGCTTCCAGGCTACCCTCCTTGGTTGGCTGGGAGCAGGTTGGTGGCCATGGCCCATGCCC
AATGGTCACAGGGCAACCCTGGGATTATGCGGGGGAGCTGGTGAGGGCAGTGGAGGTGCT
CTCCAGACTGGAAGTATGGCACAGCCCAGGTGTCTGGCCCGAACCCAATGACCAGCCTGC
CTTGTTTCTCAGGGTTTGGTGATGGGGAGGGCCAAGGGTGCCCTGCATCTGTGATGGGTC
AGTGTTCCACATGGAACCCATTACAGGGGTATCCCTTACCCCCTTCTCCACATGGAGATG
TGAGGCCCTATTTGGACACATCTCCTCCTGTCCCCCCAGATAGTGAGCCTGGAGGAAGAT
TTGCGTTGGGCCCAATGGCCCTGGGCCAGTGTCTGTCAGCCAGTTTCCCAGCCCCTGGTG
CACTGAAGCTCAGGCCTTTTCCTGGCATCCTGGTCTCCTGCACTGAACTGTGGTGAGTAT
ATCGTGGTCCTGCTGGATGCATGTGCAGGGAGGGGGTTGCCTTGGGTTTGGTCAATGTTG
AGAACCTTATATTGTTCTGAAGAGAGGTGGTGACTTAAAAATCATGCTCAATAGGATTAC
GCTGAGGCATAGCCTAGTTGAGAATTTTGGAAGAGGACAGTAGGATCCTGAAGGCTCCGG
TAGGGCCCTTGTATTTTAGGCTGGAGACTTCAAGGCTCTGAAGGGCATCTGGAGGTGGCT
CAACCTGTCTCTGTGCTCCTCCATGAGGCAGTCCAGGCTCCTTCTGTGGGCTTTCTGTTG
GCACTCTGGTTCCCTGGGCCAGGATGTTGGTGGCTCCTCCCTAAGCCCCTGTTCTCCCCT
TGTGTCTTTCAGTGAGTGCTTCTGCCCAGGTAGGCCATTTGGCATTGACCAGCATAGGTG
AGTGGATCCTGCTGGGGTCATGGGTCATGAGCAAGACCATGTGGGTCGCCGAGGGTCAGC
CTTACAGCCATAAGGGTTTTCTCAGGGAACCGACCTGAATTCCCACCTGGGAGGCATAGG
TTCTCCAGGAGGGCGGCGTTTTGGGGAATCAGACCCAAGGGGGACACCTTCCCTGAAGCC
CCGCAGGGGTGATGGTGGTCCAGGCAGGAAAGGGTTTTTTTCAGCCCCACACAAGGCAGC
TCCTAGCTGAGACTCGGTGCTTGAGTCAGACCTCAAGGATTGCCCAGGCCACATGAGGGT
GACTGAGAGCCTCTGGGGCACCACAAGGGTCACATGGGAGCTCTCAGTGCCTGGCGTGTG
ATGCACAAATGGACCTCTTGGGTTTGTTCATGGAGATTCAAGGATTGCACCCTACCATGG
CCCTGAATGGGATGGTCCCTGTTGAGAAATGGGCCATCCCAGTGGGTCTCCTGGAGCCTG
TTGGGGGGCGGCATTGTTTCCTCGAGTTGGGTGAAGGCAGAGTTCTGGCCGGCACCTGTG
GTGCTGCAGTCAGCACTGGGACTCGTGGGCGTTGGGCAAGGAGAGCCAATCCCACTGGGG
TCACCCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGGGCGGCATTGTTCTCCCTGAGGTTGGGTGAAGGCAGAGTTACCG
GTAAAGGACCTGGTGGTGCTGCAGGTCAGCACTGGGACTCGTGTGCGTTGGGCCAAGGGA
GAGCCCAAATCCCACTGGGGTCACCCTTTTTCCAACATCAAATATCTGGAAGGGTGGCCT
CCTGAAGTGGGAAGGCCTGCTGTCGAGGGACATGTCCCAGGAATTTGTCACTCAAGCTTC
TTTTGAGCTTTGGGGTCACATCCAGGGTGGCGGGGTCTTGGGCCCAAGCAAAGCAGAGGG
CACCATGTATCTCCTGATTGGCCAAGTGTTGCTGGCTCTGTGTGTGGGAGGTGTGCAGAG
TATGGATGGGGACCCACTAGAGAAAGCACGTGGCACTGCAGCTCCAGGCTATGATTTCTG
TTGCATGCTTGGAGAGGGTGCCTGGACAAGCGCGCCATGCCCAGGGACAGGCTATGCAAC
TACCAGGTCTTCAGCAGGATGTGACATCTGGGCCAACCTCCTTGGTTGGTCGTGACCTGG
TTGGTGGCCCGGGTCTGTGCCTAGTGGCCCCAGGGCAGCCCTGGGGTCATGCAGGGGAGC
CATTTTGAACAGTGGAGGTGCTCTTGGGGCCTGTAGTATGGCGCAGCCTAGGCGTTTTGC
TCAAGCCCAGTGACCCACCTGCCCTGTCCTCTCCGGGTTCAGTGGAAGGGAGGGCCAAAG
GTACTCCGTGTACTTGATGAGTCAGTATTTCACATTGAACTCATCACATGTGTCCATGGA
GGGCGAGCGAGGGTGAGCTGGCACCCCGACCCCCTTCCCCACATGGAGGTCAGTTTGTAC
ACATGTTTTCCTCCTGTCTCCCCAGATGGTGATCCCAGAGGAAAACTTGTGTTGGGCCTG
CTGTCACTGGGCCAATGTCAGTCAGCCAGGTGCCCAGCCCCTGGTGTGCTGAAGCTTGGG
CCCTTCTGGCACCCTTGGCTCCTGCACTGAGCTGTGGTGAGCCCATCTGGGTCCTGCTGG
ATGCATGTGCAGGGAGGGGGGTACCCTGGGTTGGGTCGATGATGAGAACTTTATGTTGTC
CTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTA
GGTGAGAGTTTTGGAAGAGGATGCTGGGATTCTGAGGTCCCTGACAGAGTAAATGTATTT
TGGGCTGGAGACCTCGAGGCCCTGAAGGGCATCTGGTGGGCCCAACCCTATCTCTGTGCT
CCTCTGTGAGGCAGCTCAGCCTCCCTGTGCTGGCTTGGTATCCGGGCTCCAGGTCCCTGG
TGACGGGGCACGTTGGACTCTCCTTCTTGAGCCCCCATTTTCCCCTGTGTCTTTCAGTGA
GCTCTTCTGCCCAAGTGGTCCCCGCGGCCTTGAGCAGCATAGGTGAGTGCATCCTGTTTT
GGTCATGGGCCATGAGTGATGCAGCATGGGGTCCCCAACATTCAGCCTTCGGGCCACTAG
GGTTTTCTCAGGCTGCCAACCTACTCCCCACCAGGGAGGGATGGTTTCTACAGGAAGGCC
ACTTCCTTGGGAATCCGACCCAAGGAGCACATCTTTCCTGAAGCCCTGCAGGGGTGACAG
TGGTCCAGGCAGCAAAGGGTTCCTTCAGCCCAATGTAGGGCAGCTCCCAGCTGAAACTCG
GTGGACAGGTCAGGCCTGGAGTACTGTCCAGGGCACATGGGGAGGAGGGGCACAGGGAAT
GTGGCACACCCTAGAGGTTACACTGGAGTTCTCTCTCCCTGGAGAGGGGTGAGTGATTGG
GCCCACACAGTCAGGCTGTGAAAATTCAAGGAATGCTCCACACCCATGACCTTGAATGGG
ACCAACCCTGTTGAGCAATGGGCCATCTTAGTGGTACCTCCTTGAGTCTGGTGAGGGACG
GCACTGTTTCAGTGAGGTTCGGTCAAGACTGAGCTCTGGCTGGTACCTGGTGGTGCTGCC
AGCCCTGGGACTTGGGAGCCTTCGGTCAAGGAGGCAGCTTCGATCCTGCTGGGGACAACC
CTTCCTTGAGGTCTAGTGGTGAAAAGAGTGTCCTCCTGAGGTGGGAAGGCCTGCTGTCAA
GGGAATTTGCCACCCAGGCTGCTTCTGAGCCTTGGGGTCACCTCAGGGTGGCAGGGTCTT
GTGCCCAAGGAAAGGAGAAGACACCATCTGGTTCCTGATTGGCTGAGTGTAGCCGGGCTC
TGTGTGTTGGAGTTGGGCAGGGCATGGATGGGGACCCACCAGAGAAAGTGTGGCCCAGGG
GCCCCCCAGGCTTGGAGAGGGCACCAGGGCCGGTGCCTACAATGCTCAGGTGCTGGCTGT
GAGAGGGCCAGGTCTGCAGCGGCTTTTGGCATCTGGCCAACCACCTTGGTTGGCCAGGAG
CTGGTTGATGACCCTGTCCTGTGCCCTATGTCCCTGGTATGGCCCTGGGGTCATGTGTGG
GAGCTGGCCTGAGCAGTGGACATGCTCTTGGGGTCTGCAGTAGGGTACAGCCTAGGCATC
TTGCCTGAGCCAACACTGTCTTTTGCTTGCCCTGTGTTTCCAGGGTTTGGTGGCAGAGAG
GGCCAAGGATGCCCCGCATCCGTGTTGGGTCAGTGTTCTGCATGGATCCCATCACATGGG
TATCCCTTAGCCCCTTCCCTGCATTGATGTGTGAGGCCCTGGTTGCACACACATCCTCCT
CCTGTCCCTCCAGATGGTGAGCCTGGAGGAAGACTTGTGTTGGACCCGCAGGCTGAGGGC
CAGTGTCTGTCAGCCAGGTGCTCAGCCCCCAGTGGGCTGAAACTCTGACCCTTCCTGGCA
CCCTGCTCTCCTGCACTGTGCTGTGGTGAGCACATTCGGGTTCCACTGGATGTTTGTGCA
GGGAGGGGGTTCCCTGGGTTAGGTCAATGATGAGAACAGGGCCACATGAGGGGGGCCAGA
GGGGCTACAGAGTGCCATGGGGTAACAAGGGAGCTGTTGGTTCCTGGAGTGTGGTGTGTG
AATGGGCCCATGGGGTTGGGTAGCAGAGAGTCAAGGATCCTGCTCTACCCATGGCCCTGA
ATGCGACCATCCCTGTTGAGCAGTGGGCCATCCCAGTGGGTCTTCTGGAGCCTGGTTGGG
GGGCGGAGTTGTTTCCCTGGGGTTGGGCCAAGGTTGGCTCTGGCTGGCACCTGGTGGTGC
TGCAGGTCAGCCCTGGGACTCATGGGCTTTGGGCCAAGGGACAGCCTGGATCCTGCTGGG
GGTCACCCGAGTGTTGTGAAGGGTGGCCTCCTGAGTTGGGAAGGCCCACTATTGAGGCAC
CTGTACTGGGAATTTGTTGCTCCGGCTGCATGGGAGCCATGATGTCACCTCCAGGGTGGC
GGGGTCTTGGGACCAAGCAAAGGATAGGGCAGCATGAGACTCCGGACTGGCTACATGTGA
CTGGCTATGTGTCTGGGAGGTATGTGGAGTATGGATGGGGACCCACCAGAGAAAACAAGT
GACCCTGAGACCCCAGGCTATTTTTTCTAGTACCTGCATGGAGAGGGCGCCTGTACGCAT
GCCCACTATGCCCAGGGGCAGGCTGTGCCACTGTCAGGTCTGCAATAGCATGTGGCATCT
GGGCCAGCCTCCTTGGTTGGCTGTGACCTGGCTGGTGGCCCGGACCTGTGCCCAGTGGTC
CCAGGGCAGCCCTGGGGTCATGCGGAGGAGCCGTTTTGGCCAGTGGAGGTGCTCTTGGGT
CCTGCAGTCCCGCATACCCTGGGCGTTTTGCCTGAGCCCAGTGACCTACCTGCCTTGTCC
TTCCCGGGTTCGGTGGCAGGGAGAGACATCTGCATAGGTGATGAGTCAGTATTTCACATG
GATCTCATCACATGTGTCCATGGAAGGGGAGCAAGCGTGAGCTGGCACTCAACACCCCCT
TCTCCACATGGAGGGTGGTCACATGTTCTCCACCTGTTCCCCTAGATGGTGAGACTTCTG
TTGGGCTCACTTTTCCTGGGCCAGTGTCCATCGGCCAGGTGCTCAGCCTTCGGTGCGGTG
AAGCTCCAGCCCTTCCTGGTGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCAG
GTTCCACTGGATGCATGTGCGGGAAGGGGGGTGCCCTGGGTTGCGTCAATGATGAGAACC
GTATATTGTCCTAAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGTG
GCCCAGCCTAGGGGAGAATTTTGGAAAAGGATGCTGGGATCCCAATTTCCCCAACAGGGC
CACTGTATTTTGTACCTGAGACCTGGAGGCTCTGAAGGGCATCTGGAGGTGGCCCAACCT
GTCTCTGCACTCTAGGTTCCCTGTGTGGGCTAGGTGTCGGTGCTCCGGTTCCCTGGGGGC
AGGGAATGTTGGTGGCTCCTTCCTGAGTCCCTGTTCTTGCCTTTGTCTTTCAGTGAGCTC
TTTCACCTAGGAGGGCTGCTTGGCATTGACTGGCATAGGTGAGTGGATCCTGCTCGTGTT
ATGGATCATGAGCCAGACCATGTGGGGTCCCCAAGGATCAGCCTTTGGGCCACAAGGGTT
TTCTCAGGGAGCTGACCTGAATTTCCACCTGAGACGGAAAGGTTCTCCTGGAAGGCAGGC
TTTTTGGAATCGGACCCAAGGAGGACACCTTCTCTGAAGCCCTGAAGGGGTGATGGTGGT
CCAGGCAGGAAAGGGTTCCTTCTGCCTAACATAGGACAGTGCCTAGTTGAGACTTAGTGC
TGTGGTAAAGCCTCGAGGACTGCCCAGGCTACATGAGGAGGGCCAGGGGGGCCAGAGGGG
CTATGGGGCACCACGGGGTTAACGGTGACCTCTTGGTCCCCAGAGTGTGGCGCGTGAATT
GACCCATGGTGTTGGGTTGTGGAGATTCAAGGATAGTGCCCCACCTATGGCCCTGAATGC
AACTGTCCCTGTTTAGCAATGGGCCATCTCAGTGGGTGTCTTGGAGACTGGTAGGGGGCG
GAGTTGTTTCCCTGTGACTGGGTTAAGGTAGATCTCTGGCCAGCACCTAGTGGTGCTGCA
GGTCAGCCCTGGGACTCTTGGGCTTTTGACCAAGGGGCAGCCTGCATCCCGCTGGGGGTC
ATCCTATCTCCGAGGTCAAGTGTCATAAAGGGTGGCCTCCTGAAGTGGGAAGGCTCACTG
TTGAGGGATCTGTCTTAGGATTTTATTGCTGAGGCTACTTCTGAGCCATGGCGTCACCTC
CAGGGTGATGGGGTCTGGGGAACAAGCAAAGGGGAGGGCACCATGTTGCTCCGGATCGGG
CAAGTGTGGCCCAGCTCTGTGTGTGTGAGGTGTGCAGAGCATGGATGGTGACCCACCAGA
GAAAGCACATGGCCCTGCAGCTCTAGGTTGTGATTTCCATGCACACTTGGAGACAGCATC
TTGATGTGTGCCCAATATGCCCAGGGGCAGACTATGCGATAGCCAGGTCTGCAGCAGTGT
GTGGCATCTGGGCCAGCCACCTTTGTTGGCCATGAGCTGGCTCATGGCCCTGGCCCATGC
CCACTGGTGTCAGGGGGCCCTGGGGTCATGTGGGGAGCCATCTGTGGCAGTGGAGGTAGA
CTCAGGGCCTGCAGTATGGCGCAACCCATGCATTTTGTCTGAGCCCAGTGACCTACCTGC
CCTGTTCCTTCAGGGTTTGGTGGCAGGGAGGGCCAAGGGTGCCCCGCGTTGGTGACGAGT
CAGTACTTCACATGGATCTCATAACATGTGTCCGTGGAGGGCAAGCAAATGTGAGCCCTC
ACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCCACTACTGCCTTCCCCACATGGAGGTCAGTTTGGACACATATCCTT
CTGCTGTCCCCCAGATGGTGAGACCGAAGGAAGACTTGCCTTGGGCCCTCTGTTCTTGGG
CCAGTGTCAGTCAGCCAGGTGCCCAGCTCTAAGTGCGCTGAAGCTTGGGCCTTTCCTGGC
ATGCTCGGCTCCTGCACTGAGCCAGGGTGAGCACATCCGGGTCCTGCTGGATGTATGCGT
GGGGCGGGGGTGCGCCCTGGGTTGGGCTGATGATGAATACCTTACATTGTCCTGAAAAGA
GGTAATGACTTAAAAATCATGCTCAATAGGATTACACTGAAGCCCAGGATAGGTAAGAAT
TAGGGAAGACGATGCAGGGATCCCAAGATCTCCAGCAAGGCCACACTTATTTTGCACTGG
AGAACTTGAGAACTTGAAGGGCATCTTGGGGGGTCCCAACCCTGTCTCTGTGCTCCTTCG
TGAGGCAGCCCAGGCTCCCCTTGCGGGCTTGGTGTCTGTGCTCCGCTTCTCCAGGGACAG
GGCAATTTGGTGCCCCTTCCTGAGTGCTCCTTCTTCCCTGTGTCCTTCAGTGAGCTCTTC
TGCCCAGGTGGGGCCCCTGGCTTTGAGCGGCATAGGTCAGTGCATCCTGTTGGGGTCACG
GGCCATGAGTGAGGCAGCATGGGGTTGTTGAGAGTCAGCCTTCAGACCACTAGGGTTTTC
TCAGGGAGCCAATCGATTACTCACCAGGAGGGATGGTTCCTCCAGGAGGGTCACTTCCTT
GGGAATCTGACCCTAGGAGCACGCATTTCCTGAAGCTCTGCAGGGTGATGGTGGTCCAGG
CAGGAAAGGGTTCCTTCAGCCTAACGTAGGGCAGTTCCCAGCTGAAACTAGGTGGGCAGG
ACAGGCTTGAGGACTGCCCAGGCCTCATGACGGGGGCCACAGGGGCTTTGGGGTGCCCTG
GGAGTCATGCTGGAGTTCTTCCCCCAAGAGGGGTGGGTGATAGGGTCCACACGGTCAGGT
TGCGGAGATTCAAGGAATGCTACCCACCCATGGCCCTGAGTGGGACCAACCCTGTTGAGC
AATGGGCCATTTTAGTGGTGCCTCCTTGAGCCTGGTAGGGGGTGGCACTGTTTCAATGCA
GTTGGGTCAAGGCTGAGCGCTGGCTGGTGCCTGATGGTGCTGCAGGCCAGCCCTGGGGCT
CATGGGCTTTAGGCCAAGGGGGCAACTCCCGTCCCACTGGGGTAATCCCTTCCTTGAGGT
CCAGTGGCGGGAAGGGTGGCCTCCTGAGGTGGGCAGACCTGCTGTCAAGGGACCTGTCCT
GGGAATTTGCCACCTATGCTGCTTCTGAGCCATGGGGTCACCTCCAGGATGGCGGGGTCT
TCAGCCCAAGGAAAGGAGAGGACACCATGTGGTTTCCGATTGGCTGAGTGTGGCCCGGCT
CTGTGTGTGGGAGGTGTGCAGGGCATGGATGGGGACTCATCAGAGAAAGAATGTGGCCCT
GGAGGCCCCCAGGCTTTGATTTCTGGTGTGTGCTTGGAGTGGGCACCAGGGTGGCACTAC
CATGCCCAGGGTCAGGCTCTGTGACTGCCAGGTCTGGAGTGGCTCCTGGCATCAGGACCA
CCCTCCTTGGCTCAACCAACCTTGAGCAGGTTGGCTGCCATGGCCCGTGCCCCATGGTCC
CAGTGCGACCCTGGGGTTGTTCAGGGGATCTGGCCTGGGCAGTGGAGGTGCTCTTGGGGC
CTGCAGTAGGGCACAGCCCAGGCCTCTTGCCCCAGCCCAGTAACCCACTTGCCCTGTCTT
TCCAGGGTTTGGTGGCAGGGAGGGCCAAGGGTGCTCTGCATCCATGTTGGGTCAGTGTTC
TGTAAGGATCCCATTACAAGGGTATCCCCTACCCACCTTCCCTACATTGATACATGAGGC
CCTGGTTGGACACATGTCCTCCTCCTGTCCCTACAGATGGTGACCCTGAAGAAAGACTTG
AGTTGAGCCCGAAGGCCCCGGGCCAGTGTCCATCATCCAGGTGCTCAGCTCCCAGTGCAC
TGAAGCTCGGACCCTTCTTGGTTCCCTGGTCTCTTGCACTGAGCTCTGGTGAGCACAACC
AGGTCCTGCTGGATGCATGCATGGGGAGGGGGGTGCCTTGGGTTGGGTTGGTGATGAGAA
CCTTATATTCTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATACGATTACACTT
AGGCCCAGCCTAGGTGAGAATGTTGGAAGAGGACGTTGGGATCCTGTGATCCCTGGAAGA
GCCACGGTATTTTGGGCTGGAGACCTGGAGGCCCTGAAAGGGCATCTGGAGGAGGCCCAA
CCCTGTCTCTGTGCTCCTGCATGAGGGTCCCCAGGCTCCCTGTCCAGCCTTGGTGTTGGT
GCTCTGGTACCCTGGGGACAGAACAAGTTGGTGGCTCTTTCCTGAGCCCCCGTTCTCCCT
TTGTGTCTTTCAGTAAGCTTTTCTGCCCAGATGGGCACCCTGGCATTGATTAGCCTCCTT
GGTTGTCCATGACCTGGCTGGTGGCCCAAGCCTGTGCCCAGTGGTCCCAGGGCAGCCCTG
GCATCATACGGGGCAGCTGTTTTGGGCAGTGGAGGTGCTCTCCAGGCCTGAAGTATGGCA
CATCCTGGGTGTTTTACCTGAGACCAGTGACCTGACTGCCTTGTCCTTCCTGGGTTTGGT
GGCAGGGAGGGTCAAGGGTGCCCTGCATTAGTGACAAGTCAGTATTTTGCATGGGTCTCA
TCACATTTGTCCATGGAGGGAAAGCAAGCATGAGCTGGCACCCAACACCCCCTTCTCCGC
ATGGAGGGTGGTCACATATCCTCCACCTGTGCCCCCAGATGGTGAGACTTGAGGAAGACT
TCCATTGGGCCTGCTTTTCCTGAGCCACTGTCTGTCAGCCAGGTTCCCAGCCCCCAATGC
GCTGAAGCTCAGGCCTTTCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCATAT
CCTGGTCCTGCTGGATGCATGTGCAGGGAGGTGGGTGCCTTGGGTTGGGTCAATGATGAG
AACATTATAGTGTTCTGAGGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGC
TGAGGCCCAGCCTAGGTGAGAATTTTGGAGGACACTGGGATCCCGAAGTCCCCTGCAGGG
ACCCTGTATTTTGGGCTGGAGACCTTGAAGCCCTGAAGGGCATCTGGAGGTGGCCCAACC
TGTCTCTGGGCTCCTCCGTGAGGCAGCCCAGGCTCTTTTTGTGGGCTTGGTGTTGGGGCT
CCAGTTCCCCAGGCCAGGGAATATTGGTAGCTCTTTACTGAGCCCCCGTTCTCCCTTTGT
GTCTTTCAGTGAGCTCTTCTGCCCAGGCAGGCCCCCTGGAAATGACAGGCATAGGTGAGT
GGATCCTGCTGGGGTCATGGGCCATGAGCCAGGCCATGTGGGGTCACCAGGGGTCCCCCT
TCTGGCCACGAGGGTTTTCTCAGGGAACCGACCTGAATTACCACTGGGGAGGCATAGGTT
CTCCAGGAGGGTGGCTATTTTGGGAATCGGATCCAAGGGGGACACCCCTGAAGCCCTGTG
GGCATGATGGTGGTCCAGGCAGGAAAGGGTCCCTTCCACCCCATGCAGGGCAGCTCATAG
CTGAGAGTCGATGCTCAGGTCAGGCCTCGAGGATTTCCCAGGTCACATGAGGGGGACAGA
GGAACTCTGGGTGCCACGGGGGTCAATAGGAGCTCTCAGTATTTGGTGTGTCATGGACAA
ATGGGCCTCTTGGGTTGGATTGTGGAGATTAAAGGATCACGCACCACCATTGCCCTGAAT
AGGACCATCCTTGTTGAGCAATGGGCCATCCCAGTTAGACTCCTGGAGCCTGGTGGAGGG
GAGGGGGTGGCATTGTTTCCCTGGGGTTGGGTCAAGGCAGAGCTCTGGCCAGCACCTGGT
GGCTTCTACAGGTCAGCCTTGGGACTTATGGGCATTGGGCCAAGGGGTAGCCTGCATCCC
ACTGGGGGTCACCCTTTTCCCGATGTCAAGTATCTCGAAGAGTTGCCTCCTGATGTGGGA
AGGCCTGCTGTCGAGGGTCATGTCCCAGGAATTTGTCTTTCAAGCTTCTTCTGAGCTTTG
GGGTCACATCCAGGGTGGCAGGGTCTTGGGCCCAAGCAAAGCAGAGGGCACCAAGTGTAT
CCTGATTGGCCATGTGGCTGTCTCTGTGTGTAGGAGGTTTACAGAGTATGGATGGGGACC
CACCAGAGGAAGCACGTGTCCCTGCAGCACCAGGCTGTGATTTCTGTTGCACACTTGGAG
AGGTTGCCTGGACGCGTGCCCTTCATGCCCAGTGACAGGCTATGCAACTACCAGGTCTGC
AGCAGGGTGTGACATCTGGGCCAGCCTCCTTGGTTGGCCGCGACCTGGCTGGTGGCCCAG
GTCTGTGCCCAACAGTCCCAGTGCAGCACTGGGGTCATGCAGGGGAGCCGTTTTGGACAG
TGGAGGTGCTCTTGGGGCCTGCAATATGATGCAGCCTGGGCGTTTTGCTCAAGCCCAGTG
ACCCACCTGCCCTTTCCTTTCTGGGTTCGGTGGAAGGGAGGGCCAACAGTGTACCGCGTA
CTTAACGAGTCAGAATTTCACATTGAACTCATCACATGTGTCCATGGAAGGCGAGCAAAG
GTGAGCTGGCACCCCCGACCCCCTTCCCCACATGGAGGTCAGTTTGGACACATGTCTTCC
TCCTGTCTCTCCAGATGGTGACCCCGGAGGAAAATTTGTGTTGGGCCCACTATCCCTGGG
CCAATGTCAGTCAGCTAGGTGCCCAGCCCCCAGTGCACTGAAGCTCAGGACCTTCCTGGT
GCCCTCGGCTCCTGCACTGAGCTCTGGTGAGCCCATCTGGGTCCTGCTGGATCCATGCAT
GGGGGGTGGGAGGGTGCCCTAGGTTGGGTCAGTGATGAGAACCTTATGTTGTCCTGAAGA
AAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGA
ATTTTGGAAGAGGATGCTGGGATTCTGAGGTCCTGACAGAGCAGCTGTATTTTGGGCTGG
AGACCTCGAGGCCCTGAAGGGCATCTGGTGGGCCCAACCCTGTCTCTGCGCTCCTCTGTG
AGGCAGCCCAGGCTCCCTGTGCTGGCTTGGTATCCGGGCTCTGGGTCCCTGGTGACGGGG
TATATTGGAGGCTCCTTTCTGAGCCCCTGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCT
GCCCAAGTGACCCCCCCAGCCTTGAGCAGCATAGGTGAGTGCATTCTGTTTTGGTCATGG
GCCATGAGTGATGCAGCATGGGGTCCCCAACATTCAGCCTTCGGGCCACTAGGGTTTTCT
CAGGCTGCCAACCTACTCCCCACCAGGGAGTGATGGTTTCTCAGGAGGGCCACTTCCTTG
GGAATCTGACCCAAGGAACATGTCTTTCCTGAAGCCCTGCAGGGGTGACAGTGGTCCAGG
AAGCAAAGGGTTCCTTCAGCCCAATGTAGGGCAGCTCCCAGCTGAAACTCAGTGGGCAGG
TCAGGCCTCAAGTATTGCCGAGGGCACATGGGGGAGTGGGGCACAGGGGATGCAGTGCAC
CCTGGAGGTCACACTGGAGTTCTCCCTCCCTAGAGAGGGATGAGTGACTGGGTCCACATG
GTCAGGCTATGGAGATTCAAGGAATGCTCCACACCCATGGCCTTGAATGGGACCAACCCT
GTTGAGCAATGGGCCATCTTAGTGGCACCTCCTTGAACCTGCTGGGGGATGGTACTGTTT
CAGTGAGGATGGGTCAAGGCTGAGCTCTGGCTGGCACCTCGTGGTGCTGCAGGCCCTGGG
ACTTTTGGACTTTGGGCCAAGGGAGCAGCTCTGATCCTGCTGGGGACAAGCCTTCCTTGA
GGTCCAGTGGTGAAAAGGGTGTCCTCCTGAGATGGCAAGGCCTGCTGTTGAGGGACCTGT
TCTAGGAATTTGCTGCCCAGGCTGCTTCTGAGCCTTGGGGTCACCTCAGGGTGGCAGGGT
CTTGAGCCCAAGAAAGGAAAAGACACCATGTGGTTCCTGATTGGCTGACTGTGACCCGGC
TCTGTGTGTCAGAGTTGGGCAGGGCATGGATTGAGACCCACCATAGAAAGCATGTGATCC
TAGAAGCCCCTAGGCTTGGAGAGGGCATCAGGGCCAGCGCCCACCACACCTAGATGAAAT
CTCTCGGACTTCCAGGTCTGCAGTGGCTCTTGACGTCTGGGCCAGCATACTTGGTTGGCC
AGGAGCTGGTTGGTGGCCCTGTCCTGTGCCCTGTGTCCCCAGTATGGCCCTGGGGTTGTG
TGTGGTAGCAGGCCCGGGCAGTGGAGGTGCTCTTGGGGCCTGCAGTAGGGTGCTGCCCAG
GCATCTTGCTCGAGTCAGGTGATACGCTTGCCCTGTCTTTCCAGGGTTTGGTGGCAGGGA
GGGCCAAGGGTGCCCAGTGTCCATGAGGGATCAGTGTACAGCATGGATCCCATCACATGA
GTATCCCTTAGCCCCTTCTCTACATTGATGTGTGAGGCCCTGGTTGGACACATTTACTCT
TCCTGTCCCTCCAGATGATAAGCCTGGAGGAAGTCTTGTGTTGGGCCCACAGGCCCCAGG
CCAATGTCTGTCAGCCAGGTGCTCAGCCCCTGGTGCGCTGAAACTCTGACCCTTCCTGGC
ACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTTGCACTGGATGTTTGTGT
GGGGAGGGGGTTCCCTGGGTTGGGTCAATGATGAGAACCTGATATTTTCCTGAAGAGAGA
TGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCAGCCTAGGTGAGAATTT
TGGAAGCAGATGCTGGGATCCCAAGGTCCCTTGCAGGGCCATTACATGTTGAACTGGAGA
CCTAGAGGCTCTGAAGGGCATCTGGAGGTGGCCCAACCTGTCTCTGCGCTCCTCTGTGAG
GCAGCCCAGGCTCCCTGTGTAGGGTTGGTGTTGGTGCTATGGTTCTCCAGGGGCTGGGAA
CATCGGTGGCTCCCTCCTGAGCCCCTGTTCTCACCTTGTGCCTTTCAGATCTTCCATCCA
GGAGGTCCCCCTGGCATTGACTGACATAGGTGAGTGGATCCTGCTGGGGTCATGGGTTAT
GTGGCTCATGGGGGGTCCCAGAGATTCAGCCTTTGGGCAATAGTTTTCTCAGGGAGCAGA
CCTGAATTTCCACCTGGGAGGGAAGGATTCTTCTGGAGGGCGACTTTTTTGGGAATCAGA
CCCAAGGAGGATGCCTTCCCTGAAGCCCTGCCGGGGTGATGATGGTCCAGGCAGGAAAGT
TCCTTCTGCTTAATGCAGGGCAGCACCCAGCTGAGACTCGGTGCTCCAGTAAGGCCTCCA
GAACTGCCCAGGCCACATGAGGGGGGCCAGAGGGGCTACAAGGTGCCATGGGGGTAACAG
GGGAGCTCTTGGTCCCCAGAGCGTGGTGCATGAATGGGCCCATTCGGTTAGGTCTCGGAG
ATTTAAGGATTGCACCACACCATGGCCCTGAATGCAACCATCCCTGTTGATCAATGGGCC
ATCACAGTGGGTCTCCTGGAGCCTGGTGGGAGGCAGCGTAGTTTTCCTAGGGTTGGGTCG
AGGCAGAGCTCTGGCTGGTACCTGGTGGTGCTGCAGGTCAGCCCTGGGACTTGTGGGCTT
TGGGCTAAGGGGCAGCCTGCATCCCGCTGCGGGCCACCCTTTCTCCATGGTCGAGTGTCG
TGAAGGGTGGCCTCCTGAGTTGGGAAGGCCCACTATTGAGGCACTTGTACTGGGAATTTG
TTGCTCAGGCTGCTTGGGAGCCATGGTGTCACCTCCAGGGTGGCAGGGTCTTGGCACCAA
GCAAAGGAGAGGGCACCATGTCACTGCAGATAGGCCAAGTGTGACTGGCTCTATGTCTGG
GAGGTATGTGGAGTATGAATGGGGACCCACCAGAGAAAGCAAGTGGCCCTGCAGCTGAGG
CTATGATTTCTGGTGCACACTTGGAGAGGTTGCCTTTACGCCCAAGTACCAGGCTCAGAG
GTAGGCTATGCCACTGTCAGGTCTGCAGTGGCACATGGCATCTGGACCAGCCTCCTTGGT
TGGCCATGACCTGGCTGGTGGCCTGGGCCTGTGCCCAGTGTTCCCAGGACAGCTCTAGGG
TGCTGAGGGGGAGCTGTTTTGGCTAGTGGAGGTGCTCTTGGGTCCTGCAGTACAACACAA
CCTGGGCGTTTTGCCTGAGCCCAGTGACCTGCCTGCCTTGCCCTTCCCGGGTTCGGTGGT
AGGGAGGACCAGGTGTGCCTGGCATAGGTGATGAGTCAGTATTTCACATGGATATCATCA
CATGTGTCCATGGAGGGGAAGCAAACATGAGATGGCACCCGCCACCCCCTTCTCCACATG
AAAGGTGGTCACATGTCCTCCACCTGTTCCCCCAGATGGTGAGACTTCTGTTGGGCTCGC
TTTTCCTGGGCCAGTGTCCATCAGCCAGGTGTTCAGCCCTTGGTGCACTGAAGCTCCAGC
CCTTCCTGGTGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTTCCACTGG
ATGCATAAGTGGGAAGGGGGGTGCCCTGGGTTGGGTCAATGATGAGAACCGTATATTGTC
CTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCACCCTA
AGTGAGAAATTTGGAAGGGGATGTTGGGATCCCAAGATTTCTGGCAGGGCCACTGTATTT
TGGGTTGGAGACCTGGAGGCCCTGAAGGGCATCTGGAGGTGGCTCAACTCTTTCTCTGTG
CTCCTCCGTGTAGCAGCCCAGGCTCCCTGTGCGGGCTTGGTGTTGTTGCTTCTGTTCCTT
GGGGGCGGGGCATGTGGGTGGCTCCTCCCTGAGCCCCGGTTCTCCCTTTGTGTCTTTCAG
TGAGCTCTTCTGCCAAGGGGGTCCTCTTGGCATTGACCAGCATAGGTGAGTGGATCCTGC
TGGTGTCATGATCCATGAGCCAGGCTGCTTGGGGTTGCCGAGGGTCAGACTTCTGGCCAT
GAAGGTTTCCTCAGGGAGCTGACCCTAATTCCCGTGAGGGAGGCATGGTTTCTCCAGGAG
GGCAGCTTCCTTGGGAATCTGTGACTTGACAGTGTTGAGTCGCAGAGGTTCAAGGATCTC
ATCCCACCTGTGACCCTGAATGGGGCCGACCCTGTTGAGCAACTGGCCATCCCAGTGGCA
CCTATTGAGCCTGGTAGGGGGTGGTGCAGTTTCAGTGGGGTTGGGTCAAGGCTGAGATAT
GTGCCTGGTGGTGCTGCAGTCCAGCCCTGGGATCCATGGGCTTTGGGCTGAGGGGGAAGC
CTGCATCCTATTGGGGGTAACCTGTTCTCCAAATTTGAGTGAGAGTAACAGTGGCAATCT
GAGGTGGGAAGGCCCACTGTCTGAGGTCCTGTACTGAGAATTTGCCACCTCGGCTTCTTC
TGAGCCATAGGGTCACCTCCAGGGTCACGGGGTCTTGGGACCAAGGAAAAGAGAAGATAC
CATGTGGCCCTTGATTGGCCGAGTGTAGACCAGCTCTGTGTTTGGGAGGTGTGTGGGATG
TGGATGGGGTCCCACCAGTGAAAGCATGTGGCCTGGGTCCCCAGGCTGTGATTTTCAGTG
CCCACCATGTCCAGGGGCAGGCTATGTGACTGCCAGGTTTGCAATGGTGTGTAGCTTCCA
GCTACCCTCCTTGGTTGGCTGGGAGTGGGTTGGTGGCTGTGGCCCATGCCCGGTGGTCAC
AGGGCAGGAAGACTGCCCTGTTTTTTCAGGGTATGGTGACAGGGAGGGCCATGGGTGCCC
TGCATCCATGATGGGTCAGTGTTCCACATGGAACTCATTGTGTGGGTATCTCTTATGCCT
TCTACATATGGAGATGTGAGGCCCTATTTGGACATATGGGGTTACACCATCCTGTAACCC
CAGATGGTGAGCCTGGAGGAAGACTTGCATTGGGCCCAATGGCCCTGGGCCAGTGTCTGT
CAGCCAGTTCCCAGCCCCCGATGCGCTGAAGCTCAGGCCTTTCCTGGCACCCTGGTCTCC
TGCACTGAGCTGTGGTGAGCATATCCTGGTCCTGCTGGATGCATGCATGGGGAGGGGTTG
TCCTAGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAA
AATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACA
CTGGGATCCGGAAGACCCCTGCAGGGCCCCTGCGTTTTGGCTGGAGACCTTGAGGCCCTG
AAGGGCATCTGGTGGACCCAACTCTATCTCTGCACTCCTCCATGAGGCAGCCCAGCCTCC
CTGTACTGGCTTGGTATCCGGGCTCTGGGTCTCTGGAGACGGGGCACGTTGGAGGCTCCT
TCCTGAGCCCCCATTCTCTCCTGTGTCTTTCAGTGAGCTCTTCTGCCAAAGCGGTACCCA
CCCCCTGCCCCCAGCCTTAAGCGGCATAGGTGAGTGCATCCTGTTTTGGTCATGGGCCAT
GAGTGTTGCAGCATGGGATCCCTGACATTCAGCCTTTGGGCCACTAGGGTTTTCTCAGCT
GCCAACCTACTCTGCACCAGGGAGCGATGGTTTCTCAGGAGGGCCACTTCCTTCGGAATC
TGACCCATGGAGTACGCCTTTCCTGAAGCCCTGCAGAGGTGACAGTGGTCCAGGTAAGGA
AGGGGTTCCTTCAGCCCCAGTGTAGGGCAGCTCCCAGCTGAAACTCGGTGGACAGGTCAG
GCCTGGAGTACTGCCCAGCGCATATGGGGAGGAGGGGCATGGGGAATGTGGCGCACCCTA
GAGGTCACACTGGAGTTCTCCCTCCCTGGAGAGGGGTGAGTGACTGGGCCCATACAGTCA
GGCTGCGGAGATTCAAGGAATGCTCCAACCCATGGCCTTGTTCAATGGGACCAACCCTGT
TGAGCAATGGGCCATCTTAGTGGCACCTCCTTGAACCTGGTCAGGGATGGCACTCTTTCA
ATGAGGTTGGGTCAAGGCTGAGCTTTGGCTGGCACCCAGTGGTGCTGCAGGCTGGCCCTG
GGACTTGTGGGCTTTGGGCCAAGGGGGAAGCTTCCATCCTGCTGGGGACAACCCTTCCTT
GAGGTCCAGTGGCAGGAAGGGGGGCTTCCTGAAGTGGGAAGGCCTACTGTTGAGGGACCT
GTCCTGGGAATTTGCTGTCCAGGCTGCTTCTGAGCCATGGGGTCACCTCTAGGGTGGCGG
GGTCTTGAGCCCACGGAAAGGAGAGGACACCATGTGGTTCCTGATTGGCTGAGTGTGGTC
CGGCTCTGTGTGTCGGAGTTGTGCAGGGTATGGATTGGGACCCACCAGTGAAAGCACGTG
GCCCTGGAAGTCCCCCGGCTTGGAGAGGGCACCAGGTCTGGTGCCCACCATGCCCAGGTA
CAGGCTCTGGGACTGCCAGGTTGCAGCAGCTCTTGGCATCTGGGCCACCCTCCTTGGTTG
GCCAGGAGCTGGTTGGTGGCCCTGTCCCATGCCCCATGTCCCTGGTATGGCCATGGGGTC
GTGCGGGGGAACCGGCCCTGGCATGGAGGTGCTCTTGCAGCATGCAGTAGGGTGCATCCC
AGGCATCTTGCCTGAGCCAGATGACCCGCTTGCCCTGTCTTTCCAGGGTTTGGAGGCAGG
GAGGGCCAAGGGTGCCCCGTGTCCATGTTGGGTCAGTGTTCAGCATGGATCCCATTGCAT
GAGTATCACTTAGCTCCTTCCCAGCATTGATATGTGAGGGCCTGGTTGGACACATGTCCT
CCTGTCCCTCCAGATGGTGAGCCTGGAGGAAGACTTGTGTTGGGCCCACAGACCCCAGGC
CAGTGTACGTCAACCAGGTGCTCAGCCCACGGTGTGCTGAAGCTCTGACCCTTCCTGACG
CCCTGGTCTCCTGCACTGAGCTGTGGTGACCATATCCAGGTCCTGCTAGATGCATGCCCA
GGGAGGCAGTGTGCCCTGGGTTGGGTCAATGATGAGAACCTTGTATTGTCTTGAAGAGAG
GTGATGACTTAAAAATCATGCTCAATAGGATTACTCTGAGGCCCAGCCTAGGTGAGAATT
TTGGAAGAGGATGCTGGGATCCTGAGGTCCCCAACAGGGCCACTGTAGTTTGGGCTGGAG
ACCTGGAGGTCCTAAAGGGCATCTGGAGGGGGCCCAACCCTGTCTCTGCACTCCTCCCTG
AGGCAGCCCATGCTCCCTATTCGGGATTGGTATTGGTGCTCCACTTCACTGGGGGCAGGA
TACGTGGGTGGCTACTCCCTGAGCCCCGTTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCC
AAACAGGTGGGCTCCCTGGCATTGACCAACATAGGTGAGTGGATCCTTCTGGGATTATGG
GCCATGAGCCAGGCCATGTGGCATCCCCAAGGTTCAGCCTTTGGATCAGGCAGCCAACCT
GATTTGCCACCTGGGAGAGATGGCTTCTCCAGGAGGGTGGCTTTTTTGGGAATCGGACCC
AAGGAGGATGCCTTGCCTGAAGCCCTACTGGGATGATGGTGGTCCAGGCAGGAAAGGGCT
CCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACCTGGTGGTAATGTAGGT
CAGCCCTTGGGACTCGAGGGCTTTGGGCCAAGGGACAGCCCACATCCCGCTGGGGTCACC
CTTTCTCTGAGGTCGAGTGTCATGAAGGGTGGCCTCCTGAGGTGGGAAAGCCCACTGTTG
AAGGACCTGTACTGAGAATTTGTTGCTTAGGCTGCTTAGGATCCATGTTGTCACATCCAG
GGTGGTGGGATCTTGGGACCAAGCAAAGGAGAGGGCACAACATAGCTGCCAATGGCTATG
TGTGGCTGGCTCTGTGTCTGAGAGGTGGGTGGAGTATGAATGGGGACCCACCAGAGAAAG
CAAGTGGCCCTGCAGCCCCAGGATGTGATTTATGGTGCAGGCTTGGAGAGGGTGCCTGTA
CCCGCCCCCACCACTCCCAGGGGCAGGCTTTGCCACTGCAGGTCTGCGGTGCCACGTGGC
ATCTGGGCCAGCCACCTTGGTTGGCCGTGACCTGGCTGGTAGCCCATGCCTGTGCCCAGT
GTTCCCAGGGCTGCCCTGGGTTCATGCGGGAGAGCTGTTTTGGGCAGTGGAGGTGCTCTT
GGGGCCTGCAGTATGGCACAGCCTGGGCATTTTGCCTGAGCCCAGTGATGTGCCTGCCTT
GTCCTTCCTGGGTTCAGTGGCAGGGAGGGCCAGGGATGCCCTACGTCAGTGACAAGTCAG
TATTTCGCATGGATCTCATCACATGTGTCCATGGAGGTGGGGGCAAGTGTGAGCTGGCAC
GCACCCCATTCTCCCCATGGAGGGTGGTCACATGTACTCCATCTGTACCCTAGATGGTGA
GACTGGAGGAAGACTTCCATTAGGCCCACTTTTCATGGGTCAGTGTCCATCAGCCAGGTG
CTCAGCCCCCAGTGCATTGAAGACCCAGCCCATCCTGGCACCCTAGTCTCCTGCACTGAG
CTGTGCTGAGCACATCTGGGTTCCACTGGAAGTTTTTTTGCAAGGAGGGGGTTCCCTGGG
TTGGGTCAATGATGAGAACCTTATATTATCCTGAAGAGAGGTGATGACTTAAAAATCATG
CTCAATAGGATTACGCTGAGGCCCAACCTAGGGGAGAATTTTGGAAGAGCATTATGGGAT
CCTGAGGTCCCCAACAAGGCCACTGTATTTTGGGCTAGAGACCTGGAGGCTCTTAAGGGC
ATCTGGAAGTGGCCCAACCTGTCTCTGTGCTCCTTCGTGACGCAGCCCAGGCTCCCTGTG
TGGGATTGGTGTTGGTGCTCCAGTTCCCTGGCATGGGGAATGTTGGTGGCTCCTTCCTGA
GCTCCTGTTCTCGCCTTGTGTCTTTCAGTGAGCTCTGACACCCAGGACATCCCCCTGGCA
TTGACTGGCATAGGTGAGTGGATCCTGCTGTGGTCCACTGGTCATGAGCCAGACCATGTG
GGGTCCCCGAAGTTCAGCCTTTGGGCCACAAGGGTTTTCTCAGGGAGCAGACCTGAATTT
CACCTGGGAGAGAAGGGTTCTCCTGGAGGGTGGCTTTTTTGGGACTCTAACCCAAGGAGG
ACCCCTTCCCTGAAGCCCTGCAGGGGTGATGGTGGTCCACACAGGAAAGTGTTCCTTCTG
CCCAATGCAGGGCAACATGCAGCTGAGATGTGGTGATCCGATAAGGCCTCCAGAACTGCC
CAGGCCATATGAGGGGGGCCAGAGGGGCTACAGGGTGCCACAGGGGTAACAGGGGAGCTC
TTGGTCCTTGGAGTGTGGTGCCTGAATGGGCCCATGGGATTGGGTTGTGTAGATTCAAGA
TCACACCCCGCCCATGGCCCTGAATATGACTCTTCCTGTTGAGTAATGGGCCATCTCAGT
GGGTCTCCTGGAGCCTGGTGGGGGGGTGGCATTGTTTCCCTGGGGTTGGGTCTAGGTGGA
GCTCTGGCTGGTGCCTGGTGGTGCTGCAGATCAGCCCTGGGACTTGTGGGCTTTGGGCCA
AGGAAAAGCCCGTATCCCACTGGGGGTCACCCTATCTCCAAGGTCAAGTGTTATGAAGGG
TGGCCCCCTGAGATGAGAAGGCCTACTGTCGAGGGATCTGTCCCAGGATTTTGTTGCTCA
GGCTGCTTCTGAGCCATGGCATCACATCCACAGTGGCAGGGTCTTGGGCCTGAGCATAGC
AGAGGGCACCATGTCATTCTGGATTGGCCAAGTATGGCCTAGCTCTGTGTGCCAGAGGTG
TGCAGAGCATGGATGGTGACCCACCAGAGAAAGCATGTGGTCCTGCATCCCAGGCTGTGA
TTTCCGGTGCATACTTGGAAAGGGTGTCTTGATTCGTTCCCACCATGCCCAGGGGCAGAC
TACGTGATAGCCAGGTCTGCAGCCTGACCACGTGTGGCATCTGGGCCAGCCACCTTGGTT
GGCCGTGAGCTGGCTGGTGGCCTTGGCCTGTGGCCAGTGGTGCCAGGGCGGCCCTGGGGT
CATGTGGGAGAGCCATCTTGGGCAGTGGAGGTGCTGTCGGGGCCTGCAGTACAGTGCAGC
CTGAGCATTTTGCCTGAGCCCAGTCACCTGCCTGCCCTGTTCCTCCAGAGTTTGGTGGCA
GGGAGGGCCAAGGGTGCCCCGCGTCTGTGACAACTCAGTAATTCACATGGATCACATCAC
ATTTGTCCTTGGAGGGCAAGCAAATGTGAGCCCCCACCCCCCACTGCCTTCCCCACATGG
AGGTCATTTTGGACACATATCCTCCTCTTGTCCTCCTAGATGGTGAGACTGGAGGAAGAC
TTGCGTTGGGCCTGCTGTTCCTGGGCCAGTGTCAGTCAGTCAGGTTCCCAGGTCCAAGTG
TGCTGAAGCTCAGGCCCTTCCTGGCACCCTCAGCTCCTGCACTGAGCTGGGGTGAGCACA
TCCAGGTTCGGCTGTTTGCATGTGAAGGGAGGGGCGTGCCGTGGGTTGGGCTTATATTGT
CCTGAAGAAAGGTGATGACTTAAAAATCATGCTCAATAGTATTATGCTGAAGCCCAAGCT
GGGTAAGTATTTTGGAAGATGAGGCTGGGATCCCGAGATCCCTGGCAGGGCCACACTTAT
TTTGGGCTGGAGAACTTCAAGACCTGAAGGGCATCTTGGGGGGGCCGATCCTGTCGCTGT
GCTCCTCCGTGAGGCAGCCCAGGCTCCCCTTGCAGGCTTGGTGTCCGTGCTCCACTTCCC
CAGGGGTGGGGCAATTTTTTGGCCTCTTCCTGAGCCCTCCTTCTTCCCTGTGTCCTTCAG
TAAGCTCTTCTGCCCAGGTGGGGCCCCTGGCTTTGAGCGGCACAGGTCAGTGCATCCTGT
TGGGGTCATGGGCTATGAGCGAGGCAACATCGGGTCGTCGAGAGTCAGCCTTTGGCCCAC
TACGATTTTCTCAGGGAGCCAAGAGGTTACCCATCGGGAGGGATGGTTCCTCCAGGAGGG
TCGCTTCCTTCGGAATCTGACCCTAGGAGCACGCATTTCCTGAAGCTCTGCAGGGTGATG
GTGGTCCAGGCAGGAAAGGGTTCCTTCAGCCCAACGTAATGTAGTTCCCAGCTGAAACTT
GGTGGCAGGTCAGGCTCAAGGACTGCTCAGGCCACATGATGGGGCCACAGGGGCTTTGGA
GTGCCCTGGGGGTCATGCTGGAGTTCTTGCCCCAAGAGGGGTGGGTAATAGGGCCCATGC
GGTCGGGCTGCAGTGATTCAAGGAATGCTACCCACCCATGGCCCTGAATGGGACTGACCC
TGTTGAGCAATGGGCCATTTTAATGGTGCCTCCTTGAGCCTGGTAGGGAGTGGCATTGTT
TCAATGCAGTTGGGTCAAGGCTGAACTCTGGCTGGTGCCCGGTGGTGCCCACATGGGCTT
TGGGCCAAGGGGGCAGCTCATATCCCGCTGAGGTCACCCCTTCCTTGAGATTCAGTGGCG
GGAAGGGTGTTCTCCTGAGGTGGAAGACCTGCTGTCAAGGGACTTGTCCTGGGAATTTGC
CACCTAGGCTGCTTCTGAGCCATGGAGTCACCTCCAGGGTGGCAGGGTCTTGAGCCCAAG
GAAAGGAGACACCATATGGTTTCCAACTGGGAGTGTGGCCCGGCTCTGTGTGTGGGAGGT
GTGCAGGGCATGGATAGGGACCCATCAGAGAAAGCATGTGTCCCTGGAGGCCCCCAGGCT
TTGATTTCTGGTGCGTGCTTGCATTGGGCACCAGGGCAGCCCTACCATGCTCAGGGTCAG
GCTCTGTGACTGCCAGATCTGGAGTGACTCCTGGCATGAAGACCACCCTCCTTGGTTAGC
CATGAGCAGGTTGGTTGCCCTGGCCTGTGCCCTGTGGTCCTGGTGTGGCCCTGGGTTTGT
TTGAGGGAGACAGCGCAGGCAGTGGAGGTGCTCTCGAGGCCTGCAGTAGGGCGCAGCCCA
GGCGTCTTGCCCAAGCCCAGTAACCCACTTGCCCTGTCTTTCCAGGGTTTGGTGGCAGGG
AGGGCCAAGTGTGCCCCGCGTCTGAAATGGATCAGTGTTCTGCATGGATCCCATCACAAG
GGTGTCCCCTACTCACCTTCTGTGCATTGATACGTGAGGCCCTGGTTGGACACATGTCCT
CCTGTCCTTACAGATGGTGACCCTGGAGGAAGACTTGTGTCAGGCCCACAGGCCCCAGGT
CCATCAGACAGGTGCTCAGCTCCCAGTGCACTGAAGCTTGGACCCATCCTGGCACCCTGG
TGTCCAGCACTGAGCTGTGGTGAGCCCATCCGGGTCCTGCTGGATGCATGCATGGGGAGG
GGGCTGCCCTGAGTTGGGTCAATGATGAGAACATTACATTGTCCTGAAGAGAAATGATGA
CTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAG
AGGACGGCTGGGATCCTGAGATCCCAGGCAGGGTCACTATATTTTGGGCTGGAGACCTGG
AGGCCCTGAAGGGCATCTGGAAGGGGGCCCAGCCCTGTCAGTGCTCCTCGGTGAGGCAGC
CCACGCTCCCTGTGTGGGCTTGGTGTTGGTGCTCTTGTTCCCCAGGGACAGGGAAGGTTG
GTGGCTCCTTCCTGAGCCCCTGTTCTCCTTTTGTGTCTTTCAGTGAGCTTTTCCACCCAG
GTGGGCCCCCTGGAATTGACCAACATAGGTGAGTGCATCCTACTGGGATAATGGGCCATT
AGATAGTTCGTGTGGGGTTGCTGAGGTTTAGTCTTTGGGCCACAAGGGTTTTCTCAGGCA
GCCAACCTGAATTCCCACCTGGGAGAGATGGGTTCTCCAGGAGGCAGCTTTTTTGGGAAT
CAGACCCAAGGAGGACGCCTTCCCTGAAGCCCTGCAGGGGTGATGGTGGTCAGGCAGGAA
AGGGTTCCTTCTGCTCAACTCGGGGCCCAATGCAGGGCAGTGCCCCCCTGAGAATTGGTG
CTCTGGTAAGGCCTCGAGGACTGCCCAGGCCACATGAAGGAGGTCAGAGGGGCTACAGGG
AACCACAGGGGTAACAGGGGAGCTCTTGGCCCCCAGAATGTGGTGCATGAATGGGCCCAT
GGGGTTGGGTCACGGAGATTCAAGGATTACATCTCACCCATGGCCCTGAATGCGACCATC
CCTGTTGAGCAATGGGCCATCCCAGTGGGTCTCCTGGAGCCTGGTGTGGGGTGGCGTTTT
CCTGGGGTTGGGTCAAGGTGGAGCTCTGGCTGGTACCTGGTGGTGCTGCAGGTCAGCCCT
GGGACTCGTGGGCTTTGCGCCAAGAGGCAGCCTGCATCCCACTGGGGGTCACCCTTTCTC
CGAGGTTGAGTGTTGTGAAGGCTGGCCTCCTGAAGTGGGAAGGCCCACTGTCGAGGCACC
TAGACTGGGAATTGTTCCTCAGGCTGCTTAGGAGCCATGGTATCACCTCCAGGGTGGCAG
GATCTTGGGACTAAGCAAAGGAGGGGGCACCATGCAGCTCCTGATTGGCCATGTGTGGCT
GGCTCTCTGCTTGGGAAGTGTGTGGAGTATGGATGGGGACCCACCAGAGAAAGCAAGTGG
CCCTGCAGTCCCAGGATGTAATTTCTGGTGTAGGCTTGGAGAGGGTGCCTATATGCATGC
CCACCATGCCCAGGAGCAGGCTATGCCACTGCAGGATCTGCAGTGGCACCTGGCATATGG
GCCAGCCTCCTTCAGTGGCTGTGACCTGGCTGGTGGGCTGTGCTTGTGCCCAGTGGTCCC
AGGGTAGCCCTGGGGTCATGCAGGGGAGCTGTTTTGGGCAGTGGGTGTGCTCTCAGGTCC
TACAGTACAGCACAGCCTGGGTGTTTTGCTCAAGCCCAGTGACCTGCCTGCCTTGTCCTT
CCTGGGTTCGGTGGCAGGGAGAGCCAAGTATGCCCCACATTGGTGACGAGTCAGTATTTT
GCATAGATCTCGTCACACGTGACCATGGAGGATGAGCAAGCATGAGCTGGCACCAGCCAC
CCCCTTCTCCACATGGAGGGTGGTCACATGTCCTCCACCTGTGCCCCCAGATGATGAGAC
TGGAGGAAGACTCCCATTGGGCCCACTTTTCCTGGGCCAGTGTCCGTCAGCCAGGTGCTC
AGCCCCTGGTGTACTGAAGCTCCAGCCTTTCCTGGTGCTCCAGTCTCCTGCACTAAGCTG
TGGTGAGCACATCCGGGTTCCACTGGATTTTTGTGTGGGGAGGGGGTTTTCTATGTTGGG
TCAATGATGAGAATCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAA
TAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATTATGGGATCCCGA
GGTCCTCAACAAGGCCACTGTATTTTGTGCTAGAGACCTGGAGGTTCTGAAGGGCATCTG
GAGGTGGCCCAACCTGTCTCTGCGCTCCTCCGTGATGCAGCCCAGGCTCCCTGTGTGGGG
TTGGTGTTGGTGCTCTGGTTCTCTGGTGTGGGGAATGTTGGTGGCTCCTTCCTGAGCCCT
CATTCTCACCTTGTGTCTTTCAGTGAGCTCTTCCACCCAGGAGGGCCCCTTGACGTTGAC
TGGCATAGGTGAGTGGATCCTGCTGGGGTCACTGGTCATGAGCCAGACCGTGTTGGGTCC
CCGAGGTTCAGCCTTCAGTCCACAACAGTTTTCTCAGGGAGCAGACCTGAATTTCCACCT
GGGAGGGAAGGGTTCTCCTGGAGGGTGGCTTTTTTGGGAATCTAACCCAAGGAGGATGCC
TTCCCTGAAGCCCTGCAAGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCTGCCCAA
TGCAGGACAGCACCCAGTTGAGACTCGGTGCTCCAGTAAGGTCTCCAGGACTGCTCAGGC
CACATGAAGGAGGCCAGAGGGGCTATGGGGCACTACTGGGGTAATAGGGGAGCTCTTGTT
CCCTGGAGTGTGGTGTGTGAATGGGGTTGGGTTGCGGAGATTCAAGGATCACGCCCCACC
CATGGCCCTGAAAGCGACCATCCCTGTTGAGCAATGGGCCATCCCACCGGGTCTCCTGGA
GCCTGGTGTACGGTGACTTTGTTTCCCTGGGGTTGGGTCAAGGTGGAGCTCTGGTACCTG
GTCATGCTACAGGTCAGCCTTGGGACTCGTACGCTTTGGGCCAAGGGACAGCCGGCATCC
TGGTGGAGGTCACCCTATCTCCGAAGTCGAATGTCGCAAAGGGTGGCCTCCCGAGGTGGG
AAGGCCCATTGTCGAGGGACCTGTCCCAGGATTTTGTTGCTCAGGCTTCTTCTGAGCCAT
GGCATCACCTCCAGGGTGACAGGGTCTTGGGCCCAAGCAAAGGAGAGGGCACCATGTCGC
TTTGAGTTGGCCAAGTGTAGCCTAGCTCTGTGGTGGGAGGTATGCAGAGCATGGCTGGTG
ACCCACCAGAGAAAGCACATGGCCCTGCAGCCCCAAGCTGTGATTTCCGGTGCATGCTTA
GAGAGGGCGTCTTGATGTGAGCCCACCACACCCAGGGGAAGATTACGTGACTGCCAGGAC
TGCAGTGGCACATGGCATCGGAGCCAGCCTTCTTGGTTGGCCACGACCTGGCTAATGGCC
CTGGCCCGTGCCTTGGGGTCATGCAGGGGAGCCCTCTTGGACAGTGGAGGTCCTCTCATG
GCCTGCAGTATGGTGCAGGCTGGGCATTTGGCCCTAGCCCAGTGACCTACCTGCCCTGTC
CTTCCAGGGTTGGGTGGCAGGGAGGGACAAGGGTGCCCCATGTCGGTGACAAGTCAGTAT
TTCACATGGATCTCATCAAATGTGTCCATGGAGGACGAGCAAGCGGGAACTGGCACCCAC
CACTTCCTTCCCTACATGGAGGTCATTTTGGACACATGTCCTCCACCTCTCTCCCAGATG
GTGAGACTGGAGGAAGCCTTGCATTGGGCCTGCTGTTCCTGGGCCAGTGGCCATCAGCCT
GGTGCCCAGCCCCTGATGCACTGAAGCTCAGGCCCTTCCTTGCACCCTGGTCTCCTGCAC
TGAGCTGTGGTGAGCATATCCGGGTCCCGCTGGATGCATGGACGAGGTGGTTGGTCCCCT
GGGTTGGGTTGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATC
ATGCTCAATAGGATTATGCTGAGGCCCAGTCTAGGTGAGAACTTTGGAAGAGAATGCTGG
GATCCTGAGATCCCAGGCAAGGCCACTGTATTTTGGGCTGGAGAACTCGAGGCCCTGAAG
GGCCTCTCAGGGGGGTCCCACCCTGTCTCTGTGCCCCTCTGTAAGGCAGCCCAGGCTCCC
TGTGTGGGCTTGGTGTCTGGTCTCTGGTTCCCTGGGGGTGGGGCATGTTGGCGGCTCCTT
CCTGAGCCCGCTTTCTCCCCTATGACTTTCAGTGAGCTCTTCTGCCCAGGTGAGGCCCAT
GGCCTTATGCGACATAGGTGAGTGTATCCTGTTGGGGTCATGGCCATGAATGAGGCAGCA
TGGGGCCATTTAGGGTCAGCCTTCGGGCCACTAGAGTTTTCTCAGGGTGCCACCGGGGAG
GGAACGTTTCTCCAGTAGGGTCGCTTCCTTGGGAATCTGACCCTAGGAGCACGCATTTCC
TGAAGCCCTGCAGAGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCAGCCCAACATAG
AGCAGCTCCCAGCTGTAACTCGGTAGGCTGGTCAGGCCTCGAGGACTGCCCAGGCCACAT
GAGGTGGGCAACAGGGGCTCTGGGGCAGCCTGGGGATCATGCTGGAGTTCTCCCTCCCTG
GACAGTGGTGGCTGATTGGGCCCAAGCAGACAGGCCCTGGAGATTCAGGACTGCGCCCCA
TCCATGGCCCTGAATGGGACCAACCCTGTTGAGTAATGGGCCATCTTAGTGGTATCTCCT
TGAGCCTGGTAGGGGGAGGTGCTGTTTCAATGCAGTTGAATCAAGGCTGAGCTCTGGCTG
GTACCTGGTGGTGCTGCAGGCAGCCCTGGGGGTTGTGGTCTTTGGGACAAGGGGCTAGCT
CACGTCCCACTGGGGTCTCCCCTTCCTTGAGATTCAGTGGCCAAAATGGTGTCCTGCTGA
GGTGGGAAGTCCTGCTGTCGAGGGACCTGTTCTGGGAATTTGCCACACAGGCTGCTTCTG
AGCCACGGGGTCACCTCCAGGGTGGCAGGATCTTAATGCCAAGGAAAGGAGAGGACACCA
TGTGGTTTCCAATTGACCAAGTGTGGCCTGGCTCTGTGTGTGGGAGGTATAGGGCAAGAT
GAGGACCCACCAGAGAAAGCATGTGGCCCTGGAGGCCCCCAGGCTTTGATTTCTGGTGTG
TGCATGGAGAGGGCACCAGGGTGGGCACCCACCACGCCCAGGGCAGGCTCTGCAACTGCC
AGGTCTGCATTGGCTCCTGGTGTCAAGGCCAGACTCATTGGTTGGCCATGAGCAGGTTGG
TTGCCCTGACCTGTCCCCATGGTCCCAGTGCGGCCCTGGGGTTGTTCGGGGGAGCTGGCT
CGAGCAGTGGAGGTGCTCTTGGGGTCTGCAGTAGGGCACAGCCCAGGCATCTTGCCTGAG
CCCAGTAACCTGCTTGCCCTGTCTTTCCAGGGTTTGGTGGCCCGGGAGGGCCAATGATGC
TCTGCGTCCGTGTTGGGTCAGTGTTCTTCATGGATTCCATCACATTGGTATCCCCTACCC
ACCTCCTGTGCGCTGATACGTGAGGCCCTGGTTGGACACATGTCCTTCTCCTGTCACCCC
AGATGGTGAGCCTGGAGGAAGACTTGTGTTGGGCCCCCACAGGCCCCAGGCCAGTGTCCG
TCAGCCTGGTGCTCATCCCCCGGTGTGCTGAAGCTCAGATCCTCCCTGGCACCCTGGTCT
CCTGCACTGAGCTGTGGTGAGCACATTCAGTTTCCACTGGATGCATGCATGGGGAGGGGC
TTGCCCTTGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTT
AAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTACGTGAGAATGTTGGAAGAAG
ACACTGGGATCCTGAGATCTCCAACAGGGCCACTGTATTTTGGGTTGGAGACCTGGAGGC
CCTGAAGGGCATCTGGAAGGAGGCCCAACCCTGTCTCTGTGCTCTTCCTTGAGGCAGCCC
AAGCTACCTGTACGGGCTTGGTGTTGGTGCTCCAGTTCCCTGGGGCCAGGGAACATTGGT
GGCTCCTTCCTGAGCCCCATTCCTCCCTTGTGTCTTTCAGTGAGCTTTTCCTCCCAGGTG
GGCCCCCTGGCCTTGACTGGCATAGGTAAGTGCATCCTGATGGGGTCATGGGCCATCAGC
CAGGCCATGTGGTGTCGCTGAGTTTCAGCCTTTGGGCCACAAGGGTTTTCTCAGGCAGCC
GATCTGAATTCCCACCTGGGAGAGACGGGTTCTCCAGGAGGGTGGCTTTTTGGGAATTAG
ACCCAAGGAGGATACCTGAAGCCCTGCAGGGGTGACAGTGGTCCAGGCAGGAAAGGGTTC
CATCAGCCCCAGGCAAGGCAGCTCCTAGCTGACACTGAGTGCTCGGGTCAGTCCTCAAGG
ACTGCCTGAACACGAGGGGGTCCAGAGGGGCTCTGGGTGCCACGGGGGTCACATGGGAGC
TCTCAGTCCCTAGAGTGTGGTGTGTGAATGGACCCTCAGGGTTGGGTCTTAGAGATAAAA
GGATTGTGCTCCACCCATGGCCTGGAATGTGACCATCCCTGTTGAGTAATTGGCCATCCC
AGTGGGTCTCCTGGAGCCTGGTGGGAGGTGCCATTGTTTTCCTGGGGTTGAGTCAAGGCA
GAGCTCTGGCCCTTACCTGGTTGTGCTGCAGGTCAGCCCTGGGACTCGTGGGCTTTGGGC
CAAGGGGCAGCCCACATCCCACTGGGGATCACCCTATCTCTGAGATCAAGTGTCATGAAG
GGTGGCCTCCTGAGAAGGGAAGGCCCACTGTTGAGGGACCTTTCCCAGGATTTTGTTGCT
CAGGCTGCTTGGAATCCATTGTGTCACCTCCAGGGTGATGGATTTTTGGGCCCAAGCAAT
GGAAAGGGCACCATGTGTGTCCTGATTGTTCAAGTGTGTGGGAGATATGCAGAGTATGGA
TGGTGACCCACCAAAGAAAGCATGTGGCTCAGGCTGTGATTTCCAGTATGTGCTTGAAGA
GGGCGCCTGTATGCACGCCCCACATGCCCAGGGGTAGGCTATGCAACTGCCAGGTCTGCA
GTGGCGCATGGCATCTTGGCCAGCCTTCTTGGTTGGCCATGACCTGGCTAATGGCCCTGG
CCCATGCCCAGTGATCCCAGGGAAGCCCTGGGGTCATGCAGCAGAGGCCTCTTGGGCAGT
GGAGGTGCTCTCAAAGCCTGCAGTATGGCACAGCCTGGGCGTTTATCCCAAGGCCAATGA
CCTACCTGCCCTGTCCTTCCAGGGTTCGGTGGAAGGGCCAAGGGTGCTCTGTGTCAGTGA
CAAGTCAGTATTTCACATGGATCTCATCACATGTGTCCATGGAGGATAAGCAAGTGTGAA
CTGGCATGCCCTACCTCCTTCCCTACATGGAGGTCATTTTGGACACATGTTCTCCACCTC
TCTCGCAGATAGTGAGACTGGAGGAAGACTTGCATTGGGCCTGCTGTTCCTGGGCCAGTG
GCCATCAGCCTGTTGCCCAGCCCCTAATGTGCTGAAGCTCAGGCCCTTCCTCATGCCCTG
GTCTCCTGCACTGAGCTGTGGTGAGCACATCCAGGTCCCGCTGGATGCATGGACGAGGTG
GTTGGTCCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATG
ACTTAAAAATCATGCTCAATAGGATTACTCTGAGGCCCAGGCTAGGTGAGAATTTTGGAA
GAGGATGCTGGGATCCCGAGATCCCTGGCAGGGCCACTATATTTTGGGCTGGAGAACTCG
AGGCCCTGAAGGGCCTCTCAGGGGGGTCCCACCCTGTCTCTGTGCCCCTCTGTAAGGCAG
CCCAGGCTCCCTGTGTGGGCTTGGTGTCTGATCTCTGGTTCCCTGGGGGTGGGGCATGTT
GGCGGCTCCTTCCTGAGCCCGCTTTCTCCCCTATGTCTTTCAGTGAGCTCTTCTGCCCAG
GTGAGGCCCATGGCCTTATGCGACATAGGTGAGTGTATCCTGTTGGGGTCATGGGCCATG
AATGAGGCAGCATGGGGCCATTTAGGGTCAGCCTTCGGGCCACTAGAGTTTTCTCAGGGT
GCAACCGGGGAGGGAATGTTTCTCCAGTAGGGTCGCTTCCTTGGGAATCTGACCCTAGGA
GCACGCATTTCCTGAAGCCCTGCAGAGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTC
AGCCCAACATAGAGCAGCTCCCAGCTGTAACTCGGTAGGCTGGTCAGGCCTCGAGGACTG
CCCAGGCCACATGAGGTGGGCAACAGGGGCTCTGGGGCAGCCTGGGGATCATGCTGGAGT
TCTCCCTCCCTGGACAGTGGTGGGTGATTGGGCCCAAGCAGACAGGCCCCGGAGATTCAG
GACTGCACCCCATCCATGGCCCTGAATGGGACCAACCCTGTTGAGTAATGGGCCATCTTA
GTGGTACTTCCTTGAGCCTGGTAGGGGGAGGTGCTGTTTCAATGCAGTTGAATCAAGGCT
GAGCTCTGGCTGGTGCCTGGTGGTGCTGCAGGCAGCCCTGGGGGTTGTGGTCTTTGGGAC
AAGGGGCCAGCTCACATCCCTCTGGGGTCTCCCCTTCCTTGAGATTCAGTGGTGAGAAGG
GTGTCTTCCTGAGGTGGGAAGTCCTGCTGTCGAGGGACCTGTTCTGGGAATTTGCCACAC
AGCCTGCTTGTGAGCCACGGGGTCACCTCCAGGGTGGCAGGGTCTTGATCCCAAGGAAAG
GAGAGGACACCATGTGGTTTCTGATTGACCAAATGGGACCTGGCTCTGTGTGTGGGAGGT
ATAGGGCAAGATGAGGACCCACCAGAGAAAGCACGTGGCCCTGGAGGCCCCCAGGCTTTG
ATTTCTGGTGTGTGCTTGGAGAGGGCACCAGGGTGGGCACCCACCATGCCCAGGGCAGGC
TCTGCAACTGCCAGGTCTGCATTGGCTCCTGGTGTCAAGGCCAGACTCATTGGTTGGCCA
TGAGCAGGTTGGTTGCCCTGACCTGTCCCCATGGTCCCAGTGCGGCCCTGGGGTTGTTCG
GGGGAGCCGGCTCGAGCAGTGGAGGTGCTCTTGGGGCCTGCAGTAGGGCATCTTGCCCCA
GCCCAGTGACCCACTTTCCCTGTCTTTCCAGGGTTTGGTGGCCAGCAGGGCCAATGGTGC
CCTGTGTCTGTGATGAGTCAGTGTTCTTCATGGATTCCATCACATGGGTATCCCCTACAC
ACCTTCCCCACACTGATTCATGGGGCCCTGGTTGGACACATGTCCTTCTCCTGTCACCCC
AGATGGTGAGCCTGGAGGAAGACTTGTGTTGGGCCCCCACAGGCCCCAGACCAGTGTCTG
TCAGCCTGGTGCTCATCCCCCGGTGTGCTGAAGCTCAGACCCTCCCTGGCACCCTGGTCT
CCTGCACTGAGCTGTGGTGAGCACATCCAGGTTCCGCTGGATGCATGCATGGGGAGGGCC
TTGATTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAAT
CATGCTCAATAGGATTACGCTGAGGCCCAGGCTAGGTGAGAATGTTTGAAGAGGGCGCTG
GGATGCCAAGATCCCCGGCAGGGCCACTAGCCACTGTATTTTGTACTGAAGAACTTGAGG
CCCTGAAGGGCATCTCAGGGGTCCTAGCCCTGTCTCTGTGCCCCTCTGTGAGGCAGCCCA
GGCTCCCTGTGTGGGCTTGGTGTCCAGGCTCTGCTTCCTGGGGATGGGGTGTGTTGATGG
CTCCGTCCTGAGCCCATGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGGCCAGGTGGG
GCCCATGGCCTTAAGCAGCATAGGTGAGTGTATCCTGTTGGGGTCATGGGCCATAAATGA
GGCAGTGTGGGGTCATCGAGGGTCAGCCTTCAGGCCACTCAGGTTTTCTCCAGGTGCCCC
CGGGGAGGGAACATTTCTCCAGTAGGGTCACTTTCTTGGGAATCTGACCCTAGGAGCATG
CATTTCCTGAAGCCCTGCAAAGGTGATGGTGGTCCAGGCAAGAAAGGGTTCCTTCAGCCC
AACATAGAGCAGCTCCCAGCTGAAATTTGGTGGGCTCATCAGGCCTTGAGGACTGCCCAG
GCCACATGATGGGGGACACAGAAGCTCTGGGGCTCCCTGGGGGTCACACTGGAGTTCTCC
CTCCCTGAAGAGTGGTGGGTGATTGGGCCCACACAGTCAGGTGGCGGAGATTCAAGGAAT
GCCCCACACCCATGGCCCTGAATGGGAACAACTCTGTTGAGTAATGGGCCATCTTAATGG
TGCCTCCTTGAGCCTGTTGGGGGTGGGGTGCTGTTTCATTGAGATTGAGTCAAAGCTGAG
CTCTGACTGGGTGCCTGGTGGTGCTGCAGGCTGGCCCTTCTTTGGGCCAAGGGGGCAGCT
TATGTCCCGCTGGTGTCATCCCTTCCTTGAGTTCCAGTGGTGGAAAGGGTAGCCTCCTAT
GGTGGGAAGGCCTGCTGTTCAGGGACCTGTCCTGGAACTTTGCCACCCAGGCTGCTTCTG
AGCCATGGGGTCACCTCCAGGGTGGTGGGGTCTTGAGCCCAAGAAAAGGAGAGGACAGCA
TGTGGTTCCTGATTGGCCAAGGCTCCTTGTTTGGCCAGGAGCAGGTTGGTTGCCCTGGCC
CATGCCCCATGGTCCTGGTGTGGCCCTGGGGTTGTTCGGGGGAGCTGGCCCAGGCAGTGG
AGGTGCTCTCAGGGCCTGCAGTAGAGTGCAGCCCAGGCATCTTGCCCCAGCCCAGTGACC
CATTTGCCCTGTCTTTCTAAGGTTTGGTGGCCAGGAGGGCCAATAGTGCCTTGTGTCCAT
GTTGGGTCAGGGTTCTGCATGGATCCCCATCACATGGGTCTTCCCTATCCACCCTCCCTG
CACTGATATGTGAGGCCCTGGTTGTACACATGTCCTCCTCCTGTCCCTTCAGATGGTGAG
CCTGGAGGAAGACTTGTGTTGGGCCCCCACGGCCCCAGGCCAGTGTCCATCAGCCTGGTG
CTTATCCCCCGGTGCGCTGGAGTTTGGACCTTCCTGGCACCCTGGTCTCCTGCACTGAGC
TGTGGTGAGCACATGGATGCATGCTTGGGGTGGGGGTTGCCCTTGGTTGGGTCAATGATG
AGAACCTTATATTGTCCTGAAAAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTAC
GCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGCTCCCCGGAATGGCCA
CTGTATTTTGGGCTGGAGACCTGCAGGCCCTGAAGGCCATCTGGAAGGTCCAGTCCTGTC
TCTGTGCTCCTCCATGAGGCAGCCCAGGCTCCCTGAGGGGGCTTGGTGTTGGGCTCCTGT
TCCCCAGGGTTGGGGCTGATTGGTGGCTCCTTCCTGAGCCCCCGTTCTCCCCTTGTGTCT
TTCAGTGAGCTCTTCCACCCAGGCGGGCCCCCTGGCATTGACTGGCATAGGTGAGTGGAT
CCTGCTTGTGTCATGGGCCATGAGCCTGGCCATGTGGGGTCACCAAGGGTCAGCCTTTGG
GATAAGAGGGTTTCCTCAGGGAACCAACCTGAATTCCCATCAGAGAGGAGTGGGTTCTCC
AGGAGGGCCGCTTTTTGGGGAACTGGACCCAAGGAGGATAACTTCCTGAACCCTACCGGA
GTGACAGTGGTCCAGGCAGGAAAGGGTTCTTCAGCCCCACCCAGGGCAGCGCTCTGTTGA
GACTCAGTGCTCAGGTCAGGCCTGGAGGACTTCCCAGGCCATCTGAGGGGGTTAGAAGGG
AGCTCTTTGTCCATGGAGTGTGGTGCTTGAATCTGCCCCTGGGGTTGGTTTGTGGAGATT
CAAGGATGGTGCCTCACCCATGGCCCTGATTGGAATTGTCCATTGAGAAATAGGCCATTC
CAGTGGGCCTCCTGGAGCCTGGTGGGGGGTGGTGTTTTTTTTCCCTGGGGTTGAGTCATT
GATGGGGACCCACCATAGAAAGCATGTGGCTCTGGAGGCCCCCAGGCTTTGATTTCCAGT
GCCTGCTTGGAGTGGGCACCAGGGCCAGCACCCACCATGCCCAGGAGCAGGCTCTGTGAC
TGCCAGTTCTGCATTGGCTCCTGGCATCAGGACCAGCCTCCTGGGTTGGCCATGAGCTGC
TTGGTTGCCCTGACCCATTCCCCGTGGTCCTGATGTGGCCCTGGGGTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved