Pongo_pygmaeus Locus Poly:26:SNORD12
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:26:SNORD12
Pongo_pygmaeus
Poly:26:SNORD12
20_random
SNORD12, SNORD12
1001..1089, 2710..2799
3799
CAATAGCTAATATAGCAGTGATGTATAGGAAGTACACAGAAGCACACAACAGACCGTCA
AGACAATGCATTGGATATTTCAGATTCCCTTGTTGGTCATGGCAGATTCCCTGGAAAATG
TACCCTCTGTCTGAAAGTGTAAGTGAAGCCAAAGTAATTGACTGGCTACATTTTAGATTT
GAAAGTTTTTCAGTGAACAATTGCTATGTAACAAGCTACCCCTAAATTTGGTAACTTAAA
AAATGATGTGTTTGGCTTGTCTTTGTGTAGACTTGGATAGTTTTTCTGGGCTTACCTGGG
ATCTGCAATTGGCTTCTGGTCAGCTAAGTGGCTCTGTGTCTGAACTTGGCTGGCTATTGG
CTGAGGCAATGGGAGTGATGAGCTCATGTATCTGTCATCCTTCAGAGCCTAGCCTGGGCT
TATTCACACGGGGGAGGCAGGGTTCCAAGAGTGAGAGCAAAATTGCACAAGGTCTCTCGA
GATTTGGGCTCAGAACTTGCTCACTGTCATCCTGCCACATTCTATTTGTCAAAGTGTGTC
ACAACCCTATTTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCT
GGAGTGCAGTGGCTCAATCTCAGCTCACTGCAACATCCACCTCCAAGGTTCAAGTGATTC
TGCTGTGTCAGCCTCCTCGGTAGCTGGAACCACAGGTGTGTGCCACCACACCCGGCTAAT
TTTTGTATTTTTAGTAGTGGCGTGGTTTCACCTTGTTGGCCAGGCTGGTCTCAAACTGCT
GACCTCAGTAATCCACCCGCCTCAGCCTCGCAAAGTGCTGGGATTAGAGGCGTGAGCCAC
AACGCCCGGCCACAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCT
GGAGAGCCAGTGCTTTCTCGCACGGGCCTGAGAAGCCCTTGGTTGATGCAAATGATGACT
TCGCTTTTTTCCCCATCGGATCGACAATGCTGACGTCTTATATTTTGCCAGTTAGTCCTG
ATACATCGGCCTCAAAAGGCCCGGCCTTGTTCGTTTCTGACCGTGGGAAGATGGCGGTTG
ACTCCCTTTATTTGTTGGTTCACAGGTTAGAGCAGCCAGCGGGTACAGAATGGATTTTGG
AGGAGGGAGTCACCACTGGACCTCCAAGGAAGCCACGTGCAGACATCTACAACCTTCGAT
CTCTTGACGAGTAAGCCTTTGTCTCCTATGGGCCTGCTGTAGAAAACACGTGCTTTAAGA
AGCTTTAGTTTCCTAGGAAAACGTGGGATTTCACAAAGCACTTTCTATCGAGCATTTATT
AGGTATTTAAAAAAGTGTTCTGATGGCCGGGCGCTGTGGCTCACGCCTGTAACCCCAGCA
CTTGGGGAGGCCAAGGCAGGTGGGTCACCTGAGGTCAAGATTTCGAGACCAGCCTGGCCA
ACATGGTGAAACTCTGACTCTATTAAAAATACAGAAATTAGCTGGGCGTGGTGGTACGCG
CCTGTAATCCCAGCAACTCGAAAGGCTGAGGCAGGAGAATTGCCTGAACCCGGGCGGCGG
AGGTTGTAGTGAGCCGAGATTGCGCCATTGCGCTACAGCCGGGGCAACAGAGCCAGACTC
CGTCTCAAAAAAAAAAAAAAAAACACATGTTCCGAATGTTTTACTCTCACAGTTTACCTA
TTGGACCTAGGTTTCTGATGAAGAAACAGGTTTAAGAGAAATGCCTAAAGTGGAAGAACC
TTGTTAGTGAAGAGGTGTTTAACATTTTAATGCCACTTAAACATATTTTTGGATTCCATT
CTTCCTGTGTGTTTGGGCGCTTAAATTTCCAAGTGGAGGGATGATTTATTGACATATTTT
GGAAAGCCAAATGTGTTTTTCTGTTTAACTAGCCACTCAAACCAGTGCCCTACTAAACTA
ATATTTTTGCTAGAGTCCAGGACTGAGGCATTTATAAAGTCTGGGCTTCATTGGGAACAC
ATGTGAAGCTTATTGTTCCAGATTGTTCTTTTGTCAGGTAACTTGTGTTAAAATGCAACC
TCTTGGTACTTGTTCACTTCCCAACTCAGTAAATGCTAACTACTTCCTCAACTCTTCCAG
CCACACTGGCTTCTATCATGGGCCTGTACTCAGAGTGTAAGCACCGAAGACGGGGTGTTT
GGTTTGGCCACTAAATTATTGCCAGCTACAGGATACAATACAGAAGTGCTCAAACACTGA
ATGCAAATTTGCAAATACGAAGCATACCAACCAAATCTTACTCCTCATGGCTTTCAAATC
TTACTCCTCACTCAAGAACTTCCTGCTGGCATATGTGATGACTTAGCTTTTTTCCCTGAC
AGATCGACTATGTTGATCTAACTTTTCTAAGCCAGTTTCTGTCTGATATGCCAGCTCCTT
TGTCCCAGCTCTCCTGGGCATCTAGCTGATGGGAGCTCATTTTTCTGTTTTTTTTCATTT
CAGGTTTATTGTTGGCTAAAACCAACCAGGATGAATGCGGGCGTTGGAAGTAGAATATAT
ATATATACATATAAAATTGGTAAGTGGTGCCAACACGTCTTCCTTGGCTGAGTAGACACA
GGCTCTGGAGGGGGTAGTAGCTGCTTTTCAGTGTGAGTTTGTCACCCTACTTCTGTACGA
CTCAAATGTGGCCTTTGCAGCTGATGATACAACTTCTTTCCCCATCAGATCGACCCTGTT
GATCTCTACACTATTGGCCAGTTTTGTCTGATGCATTGGCCCCAGTAGTAACTCCTGTCT
TTGTTTTCTTCTTATCTTTATCAGAGACTATTGCTTGGTCATGGGAACTGGGCTTACTCT
ATTTTTTCCAGCATTCAGATGGCTTATTTTGACCTGTTTCTATAGGTTGGGAGCCACGTG
TACCAGTGTGTTGATCTTGGCTTGATTCAGTCTGCCTAGTAACAGGTGAGGTTTCTGCTT
TCTAGCTGTCAAACCCCACAGCAAAATTTGTCCAACTGGGCCTAACCTCAGGACCCATTT
CCAAGTTGGGTATGAAACTGGACTGGACAGTCATTAGGACTGACATTGGCCTGTTGGTAT
TGATAGGTCTTTGTTGGAAATAAGAGCTTGGAGTCGCAAAGAAAACGAGCACTCGAACAA
AAGATTTCTCAGCAAGGCAAATTTACTTATGCCGGAGGGTGCTGCTGCTGGCATTCCTGG
CAAGAGCACACCTAACGAGAGAAGGGGTTTAAACAAAAGAGAGAAGGGGTTTTTATTACT
AAAGTAGTCCCTGCTTCTGTGTCCTATCCCCATTGGCTGGAGTTGACGGCACAATCTAAA
CTAGTCCCGATTGGCTATGTTAAACAGTAGGGGGGTGGGTTACAGCTGTGGGAAGGGCAG
GAAAGTTGTTTACAGAGCTGCTTGCTAGGAGTGAGGGGGACTTTTCCAAATAAGGAACAG
GTTACAGGTTGAGATTGGCCAGAGAAGTTGTTTATAGAATGGATAACTAGGAGCAGGAAG
GTATGAGGAAGTTGACCTTAAGAGCAAAGAACAAGGAAGTTACAACTTTGAGGAGAAATC
CATTATATCTAACAATTTCCCCCTTTTGATTTTTATAATTATTTCTCTTCAGACTTTTTT
TTAGCATGTCTTGACTTTGTCCCTCTTGGTTCTCTAAAATTAGAATCTTAACTGAATAAT
GCGAGGGAGGATTGAGGAAGATTTTGGTGAGAGCTGTTAAAATAAGCTTTTGTATTAATC
CTCAGATACAGGGTATGATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved