Pongo_pygmaeus Locus Mono:49:SNORA7
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:49:SNORA7
Pongo_pygmaeus
Mono:49:SNORA7
X
SNORA7
1001..1140
2140
AATTTAGCCCATGATAAGTTCCATCAGTACTTCTCTCATAGGCACTCCATATAAATGTG
AGATCTCAGTGAAAGGAGAGCTTGCTGCCAAAATGTAGTTTCAACACAAGTCCCGTATAA
TCTCTCCACCCATCAACAAAGAAAATCTGAAGCCACCACTCTCTGTAAGGGTAGGCATTC
TCATTGACTACTGAAAACTAGAAGGAATGTTTCATATATCATTAATGGCTATTTTGCTCA
TAGGATGGATTTTTTATTTTATTTTATTTTTTAGACAGGATTTTTCTATGTCACCCAGGC
TGGAGTGCAGTGATATGATCATAGGTCACTGCTGCCTTGAACTCCTGGACTCAAGTGATT
CTTCCTACTCAGCCTCCCAAGTAGGTGGGACAACAGGTGCACACCACGGTGCCCAGTTAA
TTTTTTAAAAATGTTTTGTAGAGACGGGGTCTCACTTTGTACTCAGACTGGTATTGAATT
CTTGGTTTCAAGTGATCCTTCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAG
CCACTGTGCCCAGCCAGGATGGATTTCAAACTGATTTACATTGCAGTGAAACAAATCCCT
TGGGCATGAAGGAAGAACTGGCTTTAGATGTTCCCTTGTACTATCTGTAATAACTTCAGA
TAGGAAAAGAATAACTTGCTTAAATACAAGTAAAATCCAAATCCTCATTTTGGTGAAGAA
TTTTAGGATTCTCTTTCCTCAAAGTTACTTTCATAAATATAAGGAAAAATAAATATGAGT
TTCACTATCCCCTTGGTCCCTTTCCCTGCTTAAGTAGCAGAAGCACAGAAAGACCTCTAA
TCTACAAACTTGAATATCAAGAAAGACTATTGTTGATTAGGAGTTGGTACATGCTGTTCA
GATAGGGAAGGCTTATTAACACAATGTAGAAATGATGAATGAGCCTGTTCAAGTGTAGAT
AACAATGATAAGCTCAGTGCAACAGATAAAAATGAAGATCCTACCTCCCAGGATGGCATC
TGGAGAGTGGATAGTATTCTGCCAGCTTTGGAAACTGGATGAAAAGCAAATCTGGCAGAG
GTACCCATTTCATTCCCAGCTTGCTCAGTAGCTGGTGATTGGAAGAAACTCTGCAACAGT
GTTCAATCCCTGGACAGGAAACCCTCCTTCCATGATTCTTCTTTAACATGGGTCTGAGAA
AAAGAGAAATACAATATTTTTTAAAATGAAGATGCTAGCCAACTCTCACCAGAACACATA
TTTAAATTGTTTTTCAGATCTTGAGGATGATTTAACCTGATCTGTCCTTTCATTGATTCC
TCTTAAAACCAAGAGCTTGAGCTGGCTGGGTAGGGGTCCAGTTTTGGTCACAAAAGAAAG
CCCCAGGCTATTTAGATCAGAACAGGATTGATGTAGTTCTAGATTGGGTTGGGTATCCTG
CAAGTGGAACCAACTTATCCTGGGCAAGTGTGAACAGATTGAAAAGCTTGTTCATTGAAA
TACATAGCGTACTTCTCCTAGGGCATTCAAAACATTTCAAAGAAAGAGCCTCCGTGCATA
AGTGAAATTGAGCGCATATACTAATGAGAAGGTGTACAACTCACAAGAGGATAAGGAAAG
AGATAATAGCTCTCAACATATGTATACTCTGCGGCCCAAATTTCTACTCCTAAGTAAATA
CCCAAGAAAAAGAAAGCATACAGAAAAAACATGTACAAGAATGTCCATAGCATTTTAGCC
ACCTGTTGTGCATATATCTGACACATAATAGGTGCTCAATAAATGTATAAAGTTGAACAT
ATCTTTATATCCCACATATGGTTTCACAGGCCAAGTGACACATACTAGCTGTGTCATCAG
TTCATATTTCTAGCATGTACTATAAATACTTTAATAAAAACCATTTTATTAACAATTTCC
ATTTTAGTCTATTATTGCTTTAATAAAACATTAGAATGAGGTCTTTAGGAATGATTTACT
CAAGCTTAAGATAAATATGCAGAAGGGCCCAGCAATAAAGAAAGTGTTATTAGAAAGCAA
TTTTTTCAAAATGAACACTCAGGTACTTCACTTACCATTTTAGTTCCCAGAGCCGCTCTG
TCTCACTCTAAAAGCATTTTCTTGAAAAGGGGTTGGTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved