Pongo_pygmaeus Locus Mono:201:SNORA2
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:201:SNORA2
Pongo_pygmaeus
Mono:201:SNORA2
6
SNORA2
1001..1135
2135
TAATACCTTAGCTATGTTTAGTATGCATGAGTTAATGAGTGATTAGAGTACTATGAGCA
GCACAGGTTTAGAAATGCCTATTTGCCTATAGTGCAGCCTCTTATATAGGCAAAATAAAA
GTCAAGTAAGAATTTTATTTCTCCTTTTTAAAATGCAAAGTAAAATGTGTCTTTAAAACT
CTCCCAGGAGGTGAAGGGAAGCTACCATAACACCAGGTGAGAAGGAAGACATATTGGGCT
TGGCTCATGCTTTAATTAGCTACTGTGTAAAAATGTTCAGGGATTTTCAGTTATCCACTG
GCACCCAGAGGCAATGGGTGAAGTTAACTGGAGCTAGAGCCAATTTTTTTCTTCCTAGAA
GGAGTAACAGCAGCAAACAGTAGGAGAGAAGATGCCAAGTTAGAAGTGCATATAGCTTTC
TTCCACAGGAGGCCTACACGCCGCTGCTTGAGCTGCCGCCATGTCTCTAGTGATCCTTGA
AAAGTTGCAGCATATTTTGCAAGTACTCAACACCAACATTGATGGGTGGCGGAAAACAGC
CTTTGCCATCACTGCCATTAAGGGTGTGGGCCAAAGATATGCTCATGTGGTGTTGAGGAA
AGTAGACAATGACCTCAACAAGAGGGTGGGAGAACTCACTGAGGATGAGGTGGAACATGT
GATCACCATTATGCAGAATCCATGCCAGTACAAAAGATGCCAGACTGGTTCTTGAACAGA
CAGAAGGATGTAAAGGATGGAAAATATAGCCAGGTCCTAGCCAACGGTCTGGACAACAAG
CTCTGTGAAGACCTGGAGCAAGTGAAGAAGATTCGGGCCCATAGAGGGCTGCGTCACTTC
TGGGGCCTTCGTGTCCGAGGCCGGCACACCAAGACCACAGGCTGCCATGGCCGCACCGTG
GGTGTGTCCAAGAAGAAATAAGTCTGTAGGCCTTGTCTGTTAATAAATAGTTTATATACC
CTCCCCCACCAAAAAAAAAGTGCATATAAAGTCAGCTTTCCTAGGCCCTGAATCAAGAAA
GGTGATGGTTTGCCATTGTAGCTGTTGGTTTCAAACAAGAGCCAAGATTGATGTCTTTCT
TATGGTCTGTTGGCTAATCCCAGTATGAATGGCCAGTTCAGTTGGAAGAAACACAGTCTT
GAAAAAAATAGAAAAAGCAAAGAAAAAAAAAGACAGCTTTCCAAGCTAAGTAACATTTGT
GGTCAGTGAAATAGAAATCTAGTAATGCTAAAGTAAAACAAATTTTCAGCTTAAAAATAT
TGCCTTTATTCAGAATCATAAGGGTTTTAAAAAAAATCATACCATTATGAAAGTTAAAAA
AAAATAGCACTCAATACAATGAATTACTACATTTAATATTCAAACACTTAAGGCACATTT
CTCACAGTTTACATGTGAGAATTTAGCATGATCCAAACTCAAATATCCATTTCTCATATC
TTTCAATGTCTGCAGCAGACACTGACTTAGAAACCTTTTTTAAAGCCATCTCGAAATCCT
CCATAGTTGTAGGCATGTGCATTTCTTCTTTGGAAAGATTTCGGATTTCCTCTGGAGTCA
AACCTTCAATGCGCCTTCTCATTGCCATCAAGGACGCATCCCTAGGTTTTAAGTTAAAAA
CAACAACAACACACACAGTGTTACTTTGGTTAAATGAAAACCTGTTAATAGAAAAATTTT
CAATTGATCTGTTGTAGCACTCTCTAATTATATTACACATATATGTAGTATTGTATAGAA
ACTTATTGGAATACAAAGCCTGTTGTTTTTTTAAGCAGTTAAATCTTCTGTAATGAAAAA
GGATGCTAATTTAAATAATTAATACTGAATATAAAACCCCAGAAAAAGTAAAAGTGGTGT
TAAAGCTAGCAATTTGAATTTCATTATAACTATTCAGTAAAATGAAGAATAAGCATCACA
GAGTCAGAAGAGAACCTGTTAACAAGAAAATTAAATATTTTCTCCATGTAGAGGAAAAGC
TAGGTAAGTTCAGTGGTTTCTCCTTTTCTCATTTGTGTTTAAATAAAAAAAAACTTCAGA
TGCAAACAGCTCTTTCCTTTTACCAAGTTTTATCCTTAATAGCGGCCACCATTTATGCAA
AGGGATAGCAATATAGCTGTTTGATGTATACATGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved