Pongo_pygmaeus Locus Mono:192:SNORD65
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:192:SNORD65
Pongo_pygmaeus
Mono:192:SNORD65
6
SNORD65
1001..1073
2073
ATGCTACTTCCCCAAGGATTTTCGCCCTATTTGTTCCTCATATGACACTTCTTATAATC
CCTGGAATGGATCTTAGAGTTTCGGATAAATTTCTCCTTGGGCACATATTTAGAGAAGAG
GAGCCCTCTTTTCAAAGGGAGGTCCTTCCGTGAACCCATAATCTATTTGATGGTGAGATT
AGTGGCGGCTCGGATCAGGCTACGATAAAACAGAAATGGTCGTTCTCACCTAGACGCTAC
TTCCAGAATTGTAAATATGAGCTTTTTCCGTACTGCGGTCTAAGAAATTTGAAAGACCAG
AGAACTATAAGTAGAATTTCAAGTCTCCATTGGCTAGGAGCAGGGTCTCAAAGATCATAG
ATTTAAATTCGGGACTGATAAATAATCATTGTTGGCTCCTCATGTTATGTCAACAAGAAT
ATAAATGAGGTACAATGATGGCAGATGTACGTATCCTTAGTAATCCTAAAGGCTCAGGTT
TGTTATTACTCATTGAAGCAGTGATTTGTATGTACGAGGTTCACATGAGTCACTTGTACA
CCTCCTGGGGCTTACTTGCTTAGTACAACAACCATAGCCTGTCAAGGTCATGATATCCAG
GAATTTTTTTTTCTTTTATTTTTATTATTATTATTATTATTATTATTATACTTTAGGTTT
TATGGTACATGTGCGCAATGTGCAGGTAAGTTACATATGTATACATGTGCCATGCTGGTG
CGCTGCACCCACCAACTCGTCATCTAGCATTAGGTATATCTCCCAATGCTATCCCTCCCC
CCTCCCCCCACCCCACAACAGTCCCCAGAGTGTGATGTTCCCCTTCCTGTGTCCATGTGT
TCTCATTGTTCAATTCCCACCTATGAGTGAGAATATGCGGTGTTTGGTTTTTTGTTCTTG
CGATAGTTTCAAACATTCTAGTTCATAATCAAAATTTAACACAGATTATATTCAATTACT
CCTTGAGTACACAGGCATTTATCAAAAATATATTGGAGATCAAATGATGAACTCACCTAA
AATAGCTGTAATAACCAGCAGATTGTGTAATGGTAAACCTACGGTTTTCTGAAGATTAAA
ATAATAAAATTAAATATGTATGTATATGTGTATATATATATAGCAGAATTCCCATGCAAT
TATAAAATAATTAATATATTTATGGCTCTGTGTTTATGTGTATATACACACACATAACAC
AACTTGGGTTTTTTACATTGTATTATTTTAGTTACATATTACATAGCCATGCAAAATCAC
GTAACTAGAACTAGTGAAGTCTGCAAACTCATCTTAGTTAATGAATATGAATACGACTTG
TGATTATACATCCCCTATGAAGCCAAAATACATTGGAATCAGACTTTCAGTGTTCTGTCA
TATTACCATACCTGTATAAAGTGCCTATTTGTTTTATCAACCCAAATTTCCAAATAATTA
TAAACTAATCTCTCAACATGCCCTTAAGGGGAGCAACGACTTATATTTATTGGAATTTTA
AACAAGCATAGGCCACTTATTTAACGTTTCAAGCAATGTCTATAACAAATACATTGTATT
ATTACATAATATATCAATAACCAGATATCTCTTTTAACATAATGTAAAAATTGCTATAGA
GTGTTAAAAACCATGCTTTTCTTATTCAACTTGCTGTTTGAAGTAGAAGACAAACACGGG
CACATGCATTGTAAAGGTCCATTATATTTTTACCGTATTTTCAAAGAGAAATAGTGTTCC
ATCACGTTTTCAAAGAAAAAAAAAAGAATTCAGGTGTGAATTTAAAGAAGAATCAAACTG
CAGTAACATATATTTATTTATTTATTTTTGAAAATAATCTGGGATACTGAAACCTCATAT
ATATTAGAAAAAATTTGAAACTTAAGACATGAGGATTTTTTAGACCACACCAGGGATAAT
AATTCAAACTATTCAGAGTTCAGAAGACTGTAAAAAACATCATTTTTCTTATAATATTTT
TTCCTCACACAAAATCCTGAAAGAAAACATGACGATCTCCATTCTTACACATGAGAAAAA
TGAGACTGAGGAAGCGTGAGATAGGACATTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved