Pongo_pygmaeus Locus Mono:174:SNORD56
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:174:SNORD56
Pongo_pygmaeus
Mono:174:SNORD56
2b
SNORD56
1001..1071
2071
CAAGAGCCTTTAAAAGTCCATTTTTTAAATCAATTTATTTCATTTTTGAGAATCCAAGG
AAATAAAAAAAATCAGGAAAAGTTTTACATAAAGCTGTTAGGTCATAATTTATAATATTA
CAAATTAGAAACAATCTAACTTTTTGACAGTAAGACAATGCTTGAATAAGCTGTGAAACA
GAGCTAGAATTAGCTATTATATAACCAATAAAACTATAATTATGAAGAGAATTTATTATA
TGGTAAGGTACATGCATAGGGTACTACCAGAGTAATACTACAGGAAAGACAGGAGAAAGA
TGTAGCAAATGTTAATAGGCTGTAAATGTTATAAATAATCGTGGTTATCTTTCAGTTTTA
GGATTATAGGTGTATTTTTCCCCTTTATTTCTTTGTAGTGCATATTTTCCACATTGATCA
TCAGAAAAAAAACAAGCCATATAAAATAATCAGTGCTCCTATCTGACACCTTGCATCTTG
TTGTTTGGTGTCTCTCAGTCCTGCCTTGGTCTAGCAGTTTTGGAGGTCAGAGCTATGAGA
GCTTAGCTATGGATCTGGTCAGATGCCCACTGCTCCCCAGTGCTATCCCAGCCTCTTCAC
CTACATTTACAATTATCATAATATTTGTTGAGAACCTGTTATGTGCCAAGCATCAGTTCA
GGTTCAATAATAAACTTAGAGATGTATGCCATTTTACCTTTACGTTTGCAATTAGGTTTA
TATTTATTAGGGCGACAAGACTTATTTACTTGAAATAAAAATCAGAAAACAAAAGAGCAC
TTAATCTGAACCCAAGATGTTCTATAGGCCAGTGGCTTTTAAACCTTTCAATGTAAAGAA
TATATTTTACATTGCAATCTATACATCATGGTGTGTGTGTGTGTCTACGCATATCTGGAA
ATAATGTCTCACAGAATATTTGTCATCACTATGTTTAATAAACTCTGATATTTTCTATTT
ATCCCTGTATTCCTATTCTGCATTGTTACATTTAAAATACACTATTAGCATGACAATATT
TTTTGTCAGCAGCAGCTTACCTAATGAGTGTTGAAGCTTTGGGTCTGAGTGAAGAAAAGA
TAAAAGAAGAAAAAATATGCTAATCACAATCCACTAGATTGATTCCATGACCTATTACTG
GGTTCAAATCCAGAGTTTGAAAAATACACCTATAGGCAAAAAATTCTGAAAAATGCTTTA
AAAAATCAACATAGTTCCTGTAAATTACTGGGAAAATCTGAGTTTGAAAGTAGTATTCAA
AATAGTGATGGTGTCCACGTGGGAAAGATAAACCAGCAGAATTAATCTGATAGATTCGCC
TGAAGTTCAGATCTGCTGCTTGAGAAACATCCAAATAAGTAGAAGTATACTTCAGTAGTT
AAGAGTGTAGTCTTTAGAGTTAGACTGACATGGGTTCAAGTCTAAGCCTTCCTAGATTAC
TTAATTTCTCTCTATATTGCCCCAGTGTAAAATAAAGATGGCTAGTTCTACCTTTTAAGA
AAATGTATAGAATTAACTCAGCCAAAATAAGTTGTGCCTGATATGTAGGAAGTACTTACT
ATGCACTTCCTTTGTTCAAAGCTTGGTGGACTATGTTGACTCCTGAATCTTAATGATTTA
TTTCACCTGATTCCAAATTCCACAGTGGTACTGACCAAAACTAATGTCTGCCTCTCATCC
TAAAATCTCCAACCTGGCTTATTTCTACTTTTGCCTAACTCCTATCCCTAAATCTATAAT
CTTCTGCTCTCAATAGTCCAGAGTAACAGAATTTAGCAAGTTTGAGAAGTGAGTCAGACT
CTAATTCTTTTTTAATATAGACCATGCTATGTAATGTAAACTTTATATATAGAGATGTCT
GTTTGTAGTGATAGTGTTTTTATTTTTTAAAAGTAATAAATATAAATAACATATAAAGGA
ATAAAGCAAAAAAGAAAAAACTTAGAAACAAAAATCATTGTCTTTCCACCACCTAATCTT
TTCAATCCCACTCCTTGACAGTAATTTCAAAACAATGTTAAAAGACAGTGATGAGAATGG
GCATCCTGACATTTTTCCTGACTTTAATGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved