Pongo_pygmaeus Locus Mono:301:SNORA74
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:301:SNORA74
Pongo_pygmaeus
Mono:301:SNORA74
5
SNORA74
1001..1201
2201
TAGAAAAGGGGACCTTACATATTATACTCTAATTGGAAGATGATAAGCTGCAATCAAAC
CTTGCCTGTACCAGTAAAAATGGGTGTGTCATATAGGTTGTGGGTCTTAACATTTGGAGA
ATGGATAAAATAAGACAGATTTTCCCTGAGGTTGGAAGTTGTGATGATGATAAATTAAGA
TTAAGTGAAAACCCTTTGAAGCGAAGATATCATGAATTTAGGAAATCTTGGATACTTGGA
AAGATAATCAGGTAATGAGAGAAAAGTTAGAGACTTACTGTGACAAGCCTCACTGCTTTG
TGATAGGTCTCAAGATGAAGGCAGGCTACGTCCTGGGAAACATTTTGTTATCAGACATGC
TGCTGTTAGCACAATGTATGTGGAAGGTTTGGTGTGAATGCAGTAGATTTAAGTTTTGCT
AGTGTACTTTTTCCATGCTAATTGAAAATGGTCATGCTCCAACACGATTTCACCACTTTT
TTGTTGTTGTTTCTCTCCCATCCTTCTTTTAGTTGGCTGATTGCAATTCTGGCCCAACTC
AACCCTCTCTTTGGACCACAATTGAAAAATGAAACCATCTGGTATCTGAAGTATCATTGG
CCTTGAGGAAGAAGGCATGCTCTACAGTGCTCAGTCTTTGAGGTGACTATGCTCGTGACC
TTTCTTATCGGTATGGTCAGGCAGTCAGGGTTTGCCTTGACTTTTTCTCACATTTTATGG
CCATTTTAACAATGACAAGGGCAAGCTGCTGAATGCAAACACGATCTGAAGAGCAGGAAT
AAAATTGGAACTTAAGCCTTACCTTACCTAAGTCTCAATAAGATTCTTTTTAGATTCTGC
TATCACCCTGCTTTTTTAAGTAAATACGGTTTAATTTACAAAATTAAGCTTGCATGCACT
CTTCCAGACGCAGATCAAAAAAGTAACTGTTTATACTTGGCATTGTGAGATCCAGCAACT
TTAAAAAGTGGCTGGCAGATTTAAAATTGAGCAGGTTTCTTTCCAGCAGTAGTCAGCCAT
CCGGACAGAACCGTTCCTGTGATGGTGTTACACTGCTGGGAGAGGAATGTCTTGTCTTCA
TCCGGTTGCCTGTGCCACTGTTCTGGTGGCGTCTGGCACTGGTGCAAGACAGAGCTGTGC
TTCCCCGAGAGTGTGCTAAGCATTCACTTTGGCTGCTTAGTTCTAGTCTGGGAGCAGACA
GAGAAAACAAAATTAAGGTTTTTGAATGCTTTGGATGGAGAAAGGTGCCTGCGTTCGTTT
GTTTTGTGTTGCTATAAAGGAATACATGAGACTGGGTAATTTATATTTGGCTCACAGTTC
TGCAGGCTGTATAAACATGACACCCGCATCTGTTTGGCTTCTGGTGAGGCCTCAGGAGGT
TTTTACTCATGGCAGAAAGCAAAAGGGGAGCAGCCATGTCATATGGCCAGAGAGGGAGCA
AGAGAGAGAGAAGGAGGTGCCAGGCTCATTTAAACAAGCAGCTCTTCTGTGCACTAACAA
CTACTTCACTCATTACTATGGGGAGGTGTATTAGTCCATTTTCACGCTGCTGATAAAGAC
ATACCCAAGACTGGGTAATTTATAAAGAAAGAGAGGTTTAATGGACTCACAGTTCCTCGT
GGCTGGGGAGGCCTCACAATAATGGCGGAGGTTGAAAGGCAATTCTTACATGGTAGCAAC
AAGAGAGAATCAGAACCAAGCAAAAGGGGTCTCCCCTTATAAAACCATCAGATCTCGTGA
GACTTATTCACTACCACGAGAACAGTATGGGGGAACCACCCCCATGATTCAGTTATCTCC
CACCAGGTCCCTTCCACAACACGTGGGAATTATGGAAGCTACAATTCAAGATGAGATTTG
GGTGGGGACACAGCCAAACCATATCAGGAGGGTACCAAGCCATTCATGAGGAATCCACCC
CCATGATCCAAACACCTCCCACCAGGCCCCACCTCCATCATTGGGGATCACATTTCAACA
TGAGATTTGGAGGGGACATATAATCCAAATCATATCAGTGCCTTTTGAAAATCAGTCTTT
GGTTGGGCGCAGTGCTCACGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGAT
CACGAGGTCACGAGATCAAGACCACAGTGAATCCCGTCTCTACTAAAAATACAAAAAATT
AGCTGGGCGCAGTGGCGGGCGCCTGTAGTCCCAGCTACTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved