Pongo_pygmaeus Locus Poly:34:snoU83B
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:34:snoU83B
Pongo_pygmaeus
Poly:34:snoU83B
22_random
SNORD43
1001..1064
6315
CATTAGCATGGGAGAAATGGCAGAGATAGGGCTTGAGGGAGGGATGCCCGAGATTAAAG
GTATTAAAGGTAAATTGGTGTCGCGGCAAAACCAGCGTGGGAGCCAGGAAACGAGAGTTT
CAGTCTTTCTTCGCTAATTCCAGACATAGCTGCATATCACAGGAAGAGAAGCGACCCAGC
CATTTTTCTTCGTTATTATCAAAATTGGCTGCTGCTGGACGCCGTAGATTTGTGGCGCAC
CAACCCTTAGCCCACGTCTCCGCGGCTTTTCACTAAGTTTGAACCCGACCCTTCGCCGTA
GAGTGTGTAATTTCTGTCTCCGAAGCTGACGTCAACCTCCGAACGAAAGCTAGGAGCGGA
AGAGCGTGCGTGGAAATGGCGCTCGGTACGTGCCCCCGACGCGTCGTCTGCCGCGGGGGC
GCGCTCGCACGCCGGAAGGGGCGGGGCCAGATTTGGCTTTATATAGCGGACACTAAAGGC
CGACTGGCCTCTACCGGCGGGATTTGATGGCGTGATGGTATGTGTTGTAATGGCGGCTGT
TTCATTGTCATCCGCGTCGGCATGGCTGAATCCGAGACGCATCGCCGCCATCCCGTCTTG
GCCGGCGCCGGGGGCTTGCTCTAGGGGCACGGGCGACCCAGCGGGGATTTCAGTCTGGCC
TATTTTCTGTAAAGTCGAGAGGCTTGTGGAGAAGAGCGCTTGGAGGACTGGCTTTGGGCC
TGCAGGTCGGCCAGAGAGAGGCCGTAAGGGTGGGAGCAGGCTTGGAGGCCCGGCATTTTT
AAAGCCATGAGTCATTTCTGAGTTTCGACCTCACCAATTCTATCATTAGTTGGGATTAGG
GCTCATGAGCTGCTTGTCTGGGTAGAAGGACCTTGGGTGGGGGTTCTCGGCGCCGTTCTC
ATTGGGAGGTAAAGAAGCTTGGGGGAGGGGAGTGTTGTGGAGTCCTCCTGAATATCTGGC
ATCGCTAGTGCACTTCGAAGGCCTCTGGAGCTCCCAGAAACCACAGATGATGAACTTATT
GACGGGCGGACAGAAACTGTGTGCTGATTGTCATGTTCTGATTTGGCTCTGTCGAGTTTT
CTGGCCTACGTGTATCGGTGTGATTAGTGTCCGGGCGCCGGAGGCAGCCCATAGCGTAGC
ATTGCTAGCTGCTACCCAGCGTTAGTCCCAGGAGTCCCTTTCTTTAGTGGTCAAAACCTT
GCTAATTGGCACATAAAGCTGCTTGTTAAGCAGTTTTTAGTGCTACTACTTAGTGTATTT
TTGTGTGGGTTAGAGAAAAAAATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGACTCACATCGTGCGAGAAGTCGACAGGCCAGGAT
CCAGTATGTACAGGCATCCTAAAAGTTGGGGGAATAGGAGTGGAGGGGGAGGGAACCTGT
AGAGATGGAGTCAAGCTGTTAGCAGAGGGCAGACTTTTTTTTTTAAGCAGGAGTTACAGG
TTGTCAGAACTGCTGTGACAGCAGAATGGGAATGCTCAACTTCAAGACTAATATTCCAAG
GCTACAGATGGCTAGCACTGTTTGCTTTAGGTGCTGTGTGGGGTATTAATTTCAGAGCAT
AGTAAATTTGCCAGGAACCTTAGCAAAGAGAAGTAACACTAGTGTGGGGGGTTGGAGCTG
CTGAGGCTGACATAAGAACTGCCTCATTCATTTTTTTTTCACCTGAAAGCTTAAATAATG
GCCACTTGTGTGTGTTCTACTTAGAGATGTCTAACAGCACTGCTTGCTAGCTATGGAGAC
ATTGATGTTAGGCAGTTGATATTGACTAATCTCTGAGCTCAGAGCTATTGTTAGGACATT
GAATTTTCCAGATAAATAGCAATCTTGTGTGCCTCCAGAGGTTTCTGTAGAAGAGATTTG
AAGCTGGACAGGTATTTGGCTGTCTAGGGTCCTGATATTTTTTGTTTAAATAACATAAAT
GTGCTTAGAATGAGAAATAGGTAGTAAGGACAGCCCTGTGAGTCCATACTGCAGGTGTGG
GGCCCAGTTGCCCTTCTGGCCTAAATGGGCACTTTGCATTTTCCTAGAAAACATTACATC
CCTTGCTTGGGCTCCTGCCAAGTCTGACTACTGTTTTTTTTTGCAGAGGTGAACAAGAAG
GAGGTGGTGGAGGCTGTGACCATTGTAGAGACACCACCCATGGTGGTTGTGGGCATTGTG
GGCTACGTGGAAACCCCTCGAGGCCTCCGGACCTTCAAGACTGTCTTCGCTGAGCACATC
AGTGATGAATGCAAGAGGCGTTTCTATAAGAATTGGTAAGGGAGGAGGCCATGCAGTCCC
TAGCTTGGGAGCTGGAGAGCAGGGAGCAGCACGTGCGTGGTTTCTCAGCTCTGTAGCAGG
CAGGGAGCTGCTGTCTTGGGTTTAGTTTGCCTCTTGAACAGAAAAATACCTGGGATCAGA
CTTAGCCAGCCATCTGGTTTCAGCCGGAAGCTAACACCCTCGTTCTGAGTCCAGGCTAGT
GGGTGGTGGCTGAGGACCAGTTGGTTGAAGAGTCCAACTAGAAACCAGGAGAGGTAGCAG
AATAATTCAACCCCTATAGGGGTGGCAAGGGCCTCTGGCCCTGGGTGGAATGTCCCATTT
CCTCTATCACTGAGTGGGTGCTTCCCCAAGGCAGAAAGGTTGCTTTCTCCCGGAGCAAGA
ATTTTGTTTGAATGCGTGTAACTTAAATTAACCTTGTGGACCTTTGCTCAGCTCCGCTCG
GCTCTGCCCGATGAGCTCCATCCAGGCTCCGCTTGCCGGTGGAAAAGGCTCCTTAGAAGC
CGGCAATGAGCCCCATCCCCACGCGGTGCCAGTGTGCCTTCCGCTCACCCCTTGGAGGGG
TGATGAAGGCCTGCACCTGGTCCCCTCCCCAACTCTGCTCTGCTCCTGAAGGCATAAATC
TAAGAAGAAGGCCTTTACCAAGTACTGCAAGAAATGGCAGGATGAGGATGGCAAGAAGCA
GCTGGAGAAGGACTTCAGCAGCATGAAGAAGTACTGCCAAGTCATCCGTGTCATTGCCCA
CACCCAGGTGAGCCCAGTGCCCCAGGGTGGCTTGGCCTGCCACTTAGTAGAAGTGACCTA
TGTGATCATGGGGGTCCCGTGCCCGCATGCATATGGGTAGGCTTCTCTCTTGCCAGCAGA
GGGCACTGTGTCGTTACTGGCCCTTAGCAGGGGAACCATTCTCCTTTAAAATTCCAACTG
GGCTGACCCAACTGGTGACTCACCAGTACACTGAAATGCCTGTCTGAAAGTCGGTTGTGA
GTACTGGCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTCAGGCTGGTTTTGAACTC
CTGACCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGC
CACTGCGCCCGGTGATGCATTTTCTTACTTAGAGCTTGTGCTCTCTCAAAAACAGGCTTG
TCACTAGGGCAAGTGTAGGTGGCTGAGGTAAAACCACTGCAATACCCCAAAAGGAACTGA
CCCAAAGGACAGCCACAGGAACATTGGGCTGGTAGGTGCTGGGATCTGGTTACCTGTGGT
GTGGGCCTTGTCCGCTCATCCTGACAGTAACTCAGGCACCAGTATCCAAAGTTAAGTTGT
TGCTGTTGGCAAAAATGAAAGTTCCTTCCTGTTGGTGAGGTTCAGTGACTTGTTCAGAGT
TACTGGCTTTTTGCCGTGTGCTTGACATCAATCAGGCCGCATGGAGCTGCAGTTCCTCTG
CTGTGGGAGGAGCGTTGGCAGCTGGAGCTGAGCTGTGTCTACCTCCTCCTAGATGCGCCT
GCTTCCTCTGCGCCAGAAGAAGGCCCACCTGATGGAGATCCAGGTGAACGGAGGCACCGT
GGCTGAGAAGCTGGACTGGGCCCGCGAGAGGCTTGAGCAGCAGGTACCTGTGAACCAAGT
GTTTGGGCAGGATGAGATGATCGACGTCATCGGGGTGACCAAGGGCAAAGGCTACAAAGG
TGAGCTTTGCAGTGGCTTGAGTTTCTGTGCAAACCTGGGGGAGAAGTGGTTTTCAGGCCC
AGCTGTTCAGTGATGAGGCTCAGAGTGAGCGCTGGGTACAGCGCCCGAATCAGACAGTGT
AGAACCATTCTCTACTGCCTTCCTTCTGAGAACAGCCTTGTGGTCAGAAGTAGCTGGGAT
AGCGGAGGGCCAGAGGACAACTTCTTAACATGTTCCTGGACCCTTTGCTCTTTCTAGCCT
ACTGATAACTGGAAAGGGGAGCTTGGAATTAATGTCAGTCAGTCCCTGCGGATGGGGGAG
CTTAAACTGATGGATTCCTTAAAAAGCACCCATTCAGAATTGAGTTCAGGGTTACACCCT
CAGAGCCTATCCAGCTTGACAGGGGAGACCTGTGGGTAATGCACATGAAATAATCTTTAT
CACTCCCTCAGATGACCCAGCCATGGTTGGTAATTATTGAGTAGCAGGAAGGGGTCAGTG
GGAGGTGCTGGGCGCTGAGGTGCAGTAATGTGTATCCATTCCAGGGGTCACCAGTCGTTG
GCACACCAAGAAGCTGCCCCGCAAGACCCACCGAGGCCTGCGCAAGGTGGCCTGTATTGG
GGCATGGCATCCTGCTCGTGTAGCCTTCTCTGTGGCACGCGCTGGGCAGAAAGGCTACCA
TCACCGCACTGAGATCAACAAGAAGGTGAGGTTCTGAGTGGCTCCCTGGGGGTGGGAAGA
TGACCACATGGTGGGCAGTGGGGTTTCTGTGCCTGTCAGCGCTGCTTCATTGACTGTAGC
TTACGCATCACGTGGACATGCTTCTCATGGGTCAGTTCTGGCCCATCTTGATGATTTGTA
AGGTGCCATCCTGTGAAGTGGCTGTGGTGGGGCTGACTTGGTGTGGCTGGGGATGCTAGC
CTTATTGGTCCCTGATCCCACCACCAGGGGGGTGACAGGCCTCCTGTGTTGTACAGCAGG
ATCTTTAGTTTTAGCCCAGCCACCTTACAGAAAGGAACCTGGAGGGCCAGCCAGCTTTTT
GCTCTGACCTTGGGATACGCTGTGACTGGGACTGAGGCCTCAGGTGCCTTCCTAGAGTGC
TTTGCAGGTCAGCACACTGGCGTGTCTGGGTTATTTGTCCCTAATGCCCCAGCCTTACAC
CCTTCTTGCTCATTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved