Pongo_pygmaeus Locus Mono:229:SNORD116
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:229:SNORD116
Pongo_pygmaeus
Mono:229:SNORD116
13
SNORD116
1001..1087
2087
TTCTTGAGTTCTCTAAATAGACAGTTTCATCTATCATAAAAAGAAATCTTACTTTTCTA
TATTTGCCTCTTTTATTTTTTTCCTTTCTCTACACTTTCTCTATTTCTGGTATATATCCC
ACTAAGATAAGTAACATGGTAGCCTGGACCCCTCAGTCTTGTCACTTTCAACTTTTCTAC
TAAATATAATGGTAACTCTTGGGCTAAGTATATAGTGTTTATTGTGGCCATGAATAAATT
TGTCTTTAATACACTTTTAGAGTTTTACTGATGAATGGCTTCTGAGTGTTATTGGATTTC
TTCTCACTATCTTTTAAGTTAGTGATATGCATTGTTTTATGTTACTGGCTACTGTGAGGA
AGTAGCCAAGATCCATACTATGTATTTTGTTGCAATGAAAATAATAATATGTACTCTCCA
GATTACTGTGAAGCTGGGAGAAGACTGACAAGCAGATCACCTGAAAGTGCTGGTTACGTG
GTAGACGCCGGTAAAAGATTCCCATTGCCTTTCTTGGATTTCGCTCAGCTCTAGAGAACT
GTGTCAGCTCCTCCCCATGCGTCTGGGCACATTCTGTCCCCAGGTACTGCCCCTGCTTAG
GTATTGTCTTTGCATTTCCATTTCCTGGTTTGGCATATCTCTGGGTCCTGGGATTCCTCA
TCTTCCTTCATCCCTGGCTCAGAGTTGGCTTCTTTTCAGACTGTGGCTCTGGCTCTGGCT
CTGGCTCTGGCCGTGCTGGGACTTAGCTCCTCCTCTACTTACATACAGGCCCTTCCCCAA
ACCCCACTCCCACACTACCCTCCCGCCCCCAACCATGGATCTCCCTAGAGCTCTCCACCC
CCACACCTCTGTGCTGCTGCCACTTGACATCAGACACCAAGAGTGGCTTCTTGCCACACA
TGCCAACTGGGTTTAAACCCTTGGGTTTAACAATAAAAAAGAGAAAGAAATTGTTTACAA
CATGAAGTTAGGCCAAAAAATGAATTTTAGAAATTAATTTGAGATTGATGTTGGCACCCC
CATAAAACCATTCCTTAGGAAATCCGAACAAAATGAGTGAAAACTCACTAGTTGTTCTCA
TCGAGGCTGGGCCCCAGGATTCTGATCTTGATTCAGGATCAGGGGATCCTGATCTTGATT
CAGGATTAGGAAATTCACTTCTGTGGGGGTGCCCTGGTCTGTCCTGGCTTCCAGCTGACT
GTGGCCAGCTGCTTCCACAGCAGGAGGAATTTCTTCCGTGGTGCTGGGGGCCCACGACCT
GAGGTGGGGGAAGAGATTCCAGCAGACGTGTTCCATACGGACCATCCGTGAGAATGGCTG
ACTCCCACCTGAATGACTTGCTGCTGCAGCTGGACTGTGAGGCTGACCTCCCCAGCGGTG
TGGTGCTGGGGTCGCTGCACCTGCAGAATGCCACAGTGGGAGCCAGCACCAGCTGCCAGG
TGGCTGGTAGGGTGACCCAACAGAGAGGGAGGCACCCCTCATGCTTCCCAGGGGTTGTCA
ATGTGATGGTGACCCCTGAGGTGGAAAAATTCATTAAAAATGAATGATTTCTCAAAACCA
CTACGGCCAACTCCCAGGTACAAAGCCTAATTGAATGCCACTTTTTAAGAACCAGTTTAG
TCCTGAGTTAGAGGTGGTGGAAATCTTCATCCTACTTGCAAATCAGCTGCGGTGCTTTAG
CCAACTTCTGCAGTGTTCTACGTTCTATTAAAGCTTACACTGAAAATGCTTAGTTAACAA
ATGCACTTTATCAATACAATACAGATAAGTGTTCACCTACTATTTTTAGGCAACCCACTG
TGTTTCCTTCATCATTTTAGCTACTGAGCTGTTAGAAGTCTGTATTATAGTAAAAAACAA
AACAAAACAAAACAAAAAAACTTATTTTTTTACTCAGGTTTCTGATATAACCATTTTATA
TCCCTCCTTCCTTTACCTTCTTGGTCTTGTCATTTTATTCTTGCATTATTACGTAAAAAC
AAACAATGACTTGGGGTCTTCATTGTGTTGCTTTTGTAGATACAATTTTTAAAAAGAAGG
AAAAAAAGTAATTTTCCCTTTTTCTTTCCTTATAGAAAGGCTAGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved