Pongo_pygmaeus Locus Poly:8:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:8:SNORD115
Pongo_pygmaeus
Poly:8:SNORD115
19
SNORD115, SNORD115
1001..1078, 2314..2389
3389
AAGTTGATTTTGCCAAGGTTAAGGACATGCTCAGAAGAAATAAACCCAAAATCACAGAA
ACTGTCTGGGGTCTATGTCTTTCTCCAAAGACGATTTTGAGGGCTTCATTGTTGAAAGGG
GAAAAGTGGGCTGGAGGGGAAAAAGGGAGGGTATGATAATCCATATGTTCCAAGACAAAA
GGAGCAGGTAGGGGAATGGTCAATAATGCATTCGTCTCACGCTCAGTAAATCAGCACTTT
ACATAAGATAAGGTGAACACAGAGTAGCTACCTGTGGAGATCTTTAACCTTTAATCTGTA
GCTATCTGCTTAAGAACAAAAGGAAATTCTTGCATGACTCAGCTTTCAGCTTATTTTTTT
TTTCTTTTGGCATAGTAAATTGGGGTCCCAAGTTTTTATTTTCCTTTCACACATGTGACC
CCACTATTTTCAGAATAATGAAAGCACATGTTAGAAATGGTGACACTTATTCCTAATATG
GACTTTGAAATGACTGGGTTCACAAATTTAGAATCATGGCTCTCACTGTGGGTTTTTATT
TTCAATGAGTGACTGGCTTACTTGATGGAATTCTTTCAAAAAATGTTCACTTTTTACTGA
AATTGTATTAAAATAATGTTGGAATATGTTCAGTCATGTTTACCATCTCTATAGTATGAT
ATATGATAATATGGCAGATTACTCAGTGTCAAAAGCCTGGCATACCTTGTCCTTATGATG
TTGATGAGTCAGTGGTCTAGAGCCTTAGTAATATGTCTTTTTGTGGTAGTATGGACCATA
TCTCTCCACCAAGAAATAGCCTGTGTAAGCCATATACGCAGGAACAATTTATGTCTGATT
TTGAACTATGGTCCCATTCCTATGCCTGTAGATAAAGACTGCTGAGAAGAGCAACCTCTG
GTGTTGCCACAGAGGCAAGTGCTACCACACAGGCATGGTGCAGTGAATTTAACTGATCCG
TTGTTTAAGGATGCTATTCTGGTAAGGGTTTATAAGACAACGTAACTATATGTATAAAGA
GTATCTTCAGGAGAGGTAATAATGTAAAAATCATGTTCAATAGGATTAAGTTGAGGCTCA
AAATAGTGCCAATCCTTGCAAGAAGGTGTGAGAAGTCATTAGATTTGGGGGATATGGGGT
ATTCCATTTTCAGCTTGGTAGGAAGAAACCCTTTGGGGAATCCTGCATCATTTGCCTCTA
TCTACTTCTAAAGGAACTTTTAAAATTCTTTTATCTTGTCTTTATTCTTAATACTCATAC
ATTATTAGAGAGAATATCTTGATTTATTTTTTCCTCATGGTGTGCTTCAGAATGTTCATC
CAGCAAGAGGTGTGTCATTACATGGATTATATATATGAGTTCTGTCTTTTGTAATTAAAA
AATTCCAAGTGGACCATTTGAATATTAAACATTGGCCTTCAAAATGATTACATTTACCTG
TTCATACAAAATTAGTGAGCAATGGTCCATTCTTTCCAATGAGTGACTGGTCTAATGGGG
TCCTCATTAAAACTCCTTTTTTTTTTTTTTTTTTTTTTTTTACCTGAGCATACTTTGATT
TAAAGATGAGACATTTGGTAATTCATTGCAATCAACTCTTTAGTGATTGCACAAATAGAC
AATCCATTTCTATTATTTTATTTTTTGAGTTGCTGTATATGGTGTTATGATGTTTGTGGA
TCATTGAGGCATTACTCACAACTAAAAGACTTTGGCAATTTTAGGGAATGGCTTGAGATT
CAGCTATAGGTTAACCTTGATTGAAATTGAATACAATACAGGTAGTCTGAAATCTCATTT
CCTTATCCTGAGTCTCACTCAGGTGTCATTAGATTTGTTATAAAGAAATGCATACACTAT
GTATGATGCCAGTTGTTACTGATATGAAGAGGATAAGAAGCTTTTATTTCTGCAGGGAAA
TCATCCCTTACCAGGTCGTCAAAAGACATGATACCTATGTGCTCGGCCCTTACTATACAC
GGGGAATCAGTGGTCTACCACAGCTTAAGTAATGGGTCGTATTTGGAGTATCACACATCT
CAGTCTTGTAGAAATTAGGAACAGCAATTAGGAGTCATGCACATATAAGAGATGTAATCC
TACCCTTTGACTATAGCCTACTCTTGTCTTTTACAGAGAAGACTGTGGAGGAAGAAAACC
TTTTACCCTGTTGTTCAGGGAGAAACTGACACCACTCAACTGCCTGGCACTGAAAATGTG
GCATCCAGTCCACTTTACCACCAGTGTTTAAGGAAACCATCTCTGGTAAGCATATTTGAT
CTAAGTGTGCATAGGCATATGAGTGCCATGGGCTGGGTCAATGATGAGATGTTACCTTGA
AGAGAAGTGATGACATAAAAATTAAGCTCAGTTGGATTATGCTGAGGCCCAGCCTAGGTG
ACAATTGTGAGACAAGAAGTTTGGATTTCTTAGTTTCCTTCCATTGGGGATTTTATTTTG
GGATTCTGGCAATGGAATCTTTCTGTGAAACTTGTTTTGCACACTTCTATCTGTGTGCTT
CTAAGTAAACTATAAATTCTGATTCTTTAAGTGCTATTTAAGTTTCCTACAATTCCTAAT
TTTCTTGAATATTTGGCACTAAGACCCTTGCTCTTTTTCTCTCACTGGATGATTTAGTAA
GTCCTACTGGCACTATTCTATCGAGTGGAGGTGAGAGGCTGCCTTTGCTGACTGAAAAAT
TCCAAATAGATAATTGAACTAGTGAAGACTGAGCTCTATAATAATTAGATTATTCATTCA
GACAACATGAATATCATGATAGGGTTTTCTTCTCAATGATTGACTGACACATGTGATGCA
ATCCTCATGAGAAAATCCTTACTTTTTTCCTATGATTGATTGTTTTCAGGGTTGAGAAAT
ATGATACATTGGAATTTTGCTCAATGCGCTACAGTTATCATGGTCTAAATATACAGACAA
AATTTCCTGTAATGTTAGTATAATATTTTAACAGTGCTAGGATATGTTTTGATCATTGAT
GAATCTTTATGACTGAAGGGTCCTTGCAATTGGGGTAAAAATATGAGTTTCAATAATATG
TGTTTGCCCATGAAACTTGAAATTAGATAAACTGATGAGCAATCTGGGGCCTGACTTTTC
TTTCCCAAGTACATTTGGCTTCGTTTTCATTATGATGAAAGTGTGTGCTGTGAATAATGC
CAATGGTAAATAAGAACTTTATGGACACTTATGTGAATGACAGTCAGGGCCATTCCTTCA
GGCAACATGATTATTATTATGCATTTTTCTTCTCAATGAGTGACTAGCATACTTGACAGG
ATCTACAATAGGGAAACTTTATTTTTTACTAAAATTGCATTGATATAATGTTGACAAGTT
TTGTGATTATTGGTATCATCTGTAAGATAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved