Pongo_pygmaeus Locus Mono:85:SNORA3
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:85:SNORA3
Pongo_pygmaeus
Mono:85:SNORA3
12
SNORA3
1001..1127
2127
AAAATTTTATTTCTGTAAATAATAAGCATTTATGTGCATCTGTGCTTGTGTTTCTGTTT
TTCTATGTGGTTTTCAATACATTTTAAATAATTATTTTAAAAGGCACCTATTGTCACTGT
TTGCTGATGGAAAGTTTGGAATAGAACATAGCATGATTTCTGCCTTCTGGTAGCTTTACT
CTGTCTAATGCCCTCCTCTTAAGTGTGAGTGGAACCTGTGACTTGTTTCCAACTAACAGA
ATGTAATAAAAGTGATGAGATATATGTAATTATGTGCCTGTGTTACTCTTTATAATAGCA
TATAAAAGGTCATGTCTGATTTATTCATAGTTATAGCAACTAAGCATACCACACTGCAGT
GCATGCATGTAGGAGGTTCTCAATTTATTGAAAGAGTGAATAAATAACAAGTGCTGTTTG
ACTAAATAAATGTTATTGAAAAATTTTTAGCTTTTAGCCTTGTGAAGAGGCTGTTTTCCT
CGCTGGCTTTAAATAATCAAAATAATCAAGCTGCCATGTTGTGAACTTCCCTTTGGAGAG
GACCACATGTCAAAAAACTAAAGGCACCATCTTAGCCACAGTCAGCAAGTAACTGGGGCA
GGCACGCTGGTATCCTACAACAAACTACAAGTTACCACAAGCCATGTGAGCTTGGGAACA
GATCACAAAATGGAAAAAGAGTAGATGAGCCTAAACATGCAGGGCATGCTAAGGTCATGT
ATTTAAGCTTAACAAGTCTTGAATTTGCCATATTGGCAATAGATAAAAATAGAAGTCTCT
TAGCTGGGAATGTACTTTAAGAATGTTACTGATGAAAGATGAAGAATGTCTAATGACTGT
ACCAAGCAAGAGGGAAAACTACTGTCTTCTGCAAAAATAACAATGAGATGGTTAAGAATC
TGAATCTGGAAACTGAATATGGAGAAAAGAAAATAAACAATGTTATGGAATTAAATTTGT
GCTATTATATGCCAGAATAAACACTCAAAAGCTAATTTCGAGCTGACACTAGAGTAACAT
CCTGACACAGCTCTTGTCCTGGTGTGCTAGAGTTCTCGATGAATCTACTGGTCTTGATTC
ACTGGCAGGAGCAATCAGTGGCTGTTAGTATGCATATCTAAAACATGGCCTACCTAGATC
CCAGAAGGTGTGGGTTGGTAGGCATCTTTCCTCATACTCATCAGGGAGTTGGTACCTGCT
ATGGTGTATTATAAGCCATCTCTCTGTTTTTATAGGCCTACTAAAATGTTCTGTCTGGGG
AAGGAAAAGTTCCCAAAGCAGCCTATCATCATGAAAGCCAAATTCTTCAGCAGAAGAGCT
GAGAAGATTAAGAGTGTTTATGAGTATGGGGCTAGTCTTGGTTACTTAAAGTCACATGGG
GGGAGGTTTATTAAATGTTAACAAATGCTTTTTAAAAATAGCTGATGTAGAAAATTGTGT
CATTTACATTATCAAAAAATAATGAAGTACCAATCTATTAAAGATGTATAGATCTTTAAA
AGACAGAAATGACAAAACTTTATTCAAAAATGTAAAAGATTATAAAGATAAATGAAAATC
TGAAAATTGAATTCTGTTCATATGTAAGAGGCTCAATATCAGGAACATTACAGTTTTTCT
AAAATACAATCTACACAGCCAGTCTAATTCCAAAAATGTTGATATGGTTTTAAAATGAAC
TTGTCAAGAATAATTAGAATGGGCATAAACATACAATTTTAAAAGAACAAGGTGGATGAA
TAAATATATCCCTACCAGGATATATTATGCAGTTATACTAATTGTAGTAAAGTATGTTGA
CATTGGAATAGATAAATGGACCAATTGGACATAATAGAGAGCTCAGACACAGATTCACAC
AATTGTGGAAAGTTTATACGTGACAAGAGATTTAAGAATTCAGCTGGAAAACACAAATGG
TGATGAGACAACTAGTCTTCTTGTGAAAATAATAATAAGTGGATCTCAATGTTGCTGAAA
GTAAACTCCAGGGGTATTAGATAATTAAATGTGAAAATAAAGATGATAACTACTTAAAAA
GGATATATAGGGAAATATATTAATACCCTTGTAGCAACAAAGAACTAGAGATATTGAAAA
AAAAATAAAACAAATAGGCTAATGAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved