Pongo_pygmaeus Locus Mono:306:SNORD55
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:306:SNORD55
Pongo_pygmaeus
Mono:306:SNORD55
1_random
SNORD55
1001..1080
2080
AACATGTCCTTGTAGCTCAGAAAAGTTAGCTGAGCCCTCCTTTATACTCTCTTCCTAAG
TTCCGTTGATTCTGGTGGCTTTAATTACCATTTATAAGCCAATGATTCCCAAAATAACAT
CTTCAGTGCAGATCCCTTATGAGGATGACCAGTCATTAATATTCAGCTTCCTGTCAGTCC
CACTTATATGACTTAGCAAGATCTCAAAATGAACGTGTCCAGAACAGCTCCTACCTTAGC
CTACCCCATCTCAGTAAATGGCCCCAATATTTATCCGATTGATCAAGTGAGAATCTTAGG
AATCCTTGACACCGCCCTCTCCCTCAATCCCCATGTCCAATCTACCACCAAACCCTTCAA
AACAAAACCCAAGTCCACACTCGTTTCCAATTCCATTGCCTTCCACTCTTTTTCAACGCA
GCCGCACCCACATCTCATCCTAAATGACCGCCGCAGCCTCTGAAACTAGTCTCAACACGC
CCAGATCTGCCGACGCCGCAGATCCCCTTCCCCCAGCCCAAGGTCGGAGGCGAGTCGGCG
GGGGTCGGCAGAGGTCCACAGCCTGCGAGACCCTCCCAGGCTCATGGCCCTAGACTCGGC
AGCCGACACGTAAATCTCGTCGCCCGACGTTGTTTCGGCGCTCAGAAACAACGTAAAGTA
AAGGGGCGGGGCAGCGTTTTACAAACCGGACCGTGAATCTTTGCGGTTCTCTTTCCAGCC
AGCGCCGAGCGATGGGTGAGTGTTGCTCTGCATTGAGGCGGGTGATAGGGGGGTTGAGCT
CAATCAGGCCCCATCCTGCTTCACAGCCTACTGAGGAGTCCAGACGCCCCGACCCCCGGC
CAGGGACAGCCACGAGGAGTGGTGGCCCTCGGGTTTCGGCCGCCCAGCCTCTCTCTGGGG
GCTGCGAAGGCCTCTGGGCTCCGGGTTCCGGGCCGCGGGGCTGCGGGCTCCGAGCGGCGC
CAACATGGCTGCCGCGAGGAGGAGGCCCCGGCCTGGCCGCACGTGTATGATGACAACTCG
GTAATGCTGCATACTCCCGAGTGCGCGGTGGGGAAGCCAACCTTGGAGAGCTGAGCGTGC
GGCCGGCCTGGCGCGGGGGTTGGGAGCTGGCGAGTCGCTAGCACCGAGTCACAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTCTGTGTGACTAGAACCGGTCTATAATATATAGCCAGCTCGAGTCCCAGAAA
ACCTAGCAAGCCTTAAGTTTAGAGCTTCTCATTTTGGCCTTTTCAACATTAAATCCCCTT
TAGTAAGCCCTTCCCCTCTAGGGAAGTATTTGCCGGAGCACTGCCTAAAGTTGGTTTTCT
GATGCCCTGTTGTTTCTGTTCTGAATGGTTTATTTCTCATTATAAGAGCTCAGCAAAGCA
GGCAGAGTTAAAAAGCAGACATGAAAACTTTTTAAAATCGTGGACTTCACTCCTACACTG
AAATCAGGTCCTCAGAAAGACAGAAACACCATGGGACCACAGCAAAGGCAGGAGGAGGAG
GGAGGGAGGGAGGTGGACAGAACAACAAACAGGAGTTGGCTCTCAATTTTTCACATGTGC
CATTTTCTTTAGGTTTTTCTAGTTTATGGAGTCTCTTTGTTCCAGTTGAGCACACAGATA
AACTAGAGATCTCACAAGGCTTTTGCTGAGACCATCAAAGCCTTTAGCCTCTGTTGGGCC
AAATATTTTAGACCAAAAATACAGATAGACACACAAAAAGCCAGAACGAGACCAGATTGA
GTATCTCAGTGGCTGCAGCCTTTATTCCCTTTATTCTTTAGGATTCGAACTCAAACCAGA
TTCAGGGTTCTAACCCAACCAGGATTCCCCCTGGGGTGAAACTGAAACCCACAGTCTAGA
CAAGGTTGGGGGTCTTTTTTTATCTTTTTTTTTTTTTTTTTTGAGGTGGAGTTTCACTCT
TGTTGCCCAGGCTGGAGTGCAATGGTGCAATATCGCCTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved