Pongo_pygmaeus Locus Mono:126:SNORA74
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:126:SNORA74
Pongo_pygmaeus
Mono:126:SNORA74
2a
SNORA74
1001..1197
2197
AAAATTAATAAATAAATACAACTATGAGATTTATTATTGAGACACTAAGAAAGGCATTT
AACATGTCTATAAATGTGGTCAAGCTAGAAAAAAAGAGGAGCTACCTTCTAGAATAGGCT
ATTTTTACCAGCAGAATTACTATAGAAAAGAATTATGTTAAATTTCATAAATAGCTCTTC
CTGAGAGCATAATAATAACTCTGCTTCTGCTTTTCAAGAAGTCAGCCAAGAAAGGTTGGG
AGAAATCTATTATATTGTCAAAAAGCAATTTTTCATACTAGTCCATGGGACTAACAACAT
TTAGGAAGAACCTGGCTTGCCATGGAATATAGAGGATGTGGGTGAGTGTTAATGACAGTG
GGTGTCATGGCCGGGAGTGGTGACTCAGTCCTGTAATCCCAGCACTTTGGGAGGTCGAGG
AAGGCAGATCATTTGAGGTCAAGCGTTCACGACCAGCCTGGCAAACATAGTGAAACCCTG
TCTCTACTAAAAATACAAACATTAGCCTGGCATGCTTGTGTGTGCCTGTAATCATAGCTA
CTTGGGAGGCTGAGGCACAAGAATCACTTGAACCCAAGAAACAGAGGTTGCAGTGAGCTG
AGATCCCGCCACTGCACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTCAAAAAAAAAA
AAAAAAAAAAACTGTGGATGTCAAAGGTACATCTTCATATCCCATAGGACGCTTGTTTAA
ATTTTGCCAGGTCAAAGGGAGATTATTCTTATTCTGACTTTAACCCACACTGATTCTAAT
ATATCCAGTTGTGTCATTTTCCTTTAAGGAAGTACAAAGTTGCAATGAAACAGCTGAATT
GATAGGAGTTCCAAGAATTGCAACAAATAGAATAAAAAGAACAATGAAATCATTCACAAA
AGAGGCCATTCACAGACAGCTTGGTACAACTGTAGTACAAAAAAATAAAGAACAAACTGA
AGTGAAAAGTATAGCTCAGGATTCCGATTTTAAAAGTTTTATCCAGCAGTCGTTAGCTCT
CCTGGCTAGTGTGATGCCTGTGATGGTGTTTCACTGTTGCAACAGCAAGCACTGTCTTAA
TTGAGGCTTGGCTCCAGGTGCTGTTTTGGTGTGGGGCCAAGTACCTTTGGGCAGTGTTTT
GAACCTCTGAGAGTGAAATTACTCCTGTGGAGTCGGTCCTAATCTGAGTGCAAGCAATCT
TTTCTGCTAAAAAAGTAGTTCTGAGGCCAGGTGTGGTGGCTCATGCCTATAATCCCAGCA
CTTTGGGAGGCTGAGGCGGGCGGATCACTTGAGGTCAGGAGTTCGAGACTAGCATGGCCA
ACAAGGTGAAATGCTGTCTCTACTAAAAATACAAAAAATTAGCTGGGCCTGATGGCATGC
ACCTGTAGTCCCAGATACTCAGGAGGCTGAGGTGGGAGGATCGCTTGAACCCAGGAGGTG
GAGGTTGCAGTAAGCCAAAATTGCGCCACTGTACTCCAGCCTGGGTGACACAGCAAGACC
ATGTTTCAAAAAAAAAAAAAGTTTTGGGTTCAGTTTAATTTCTTTTCATTCAAAAAGATT
TTTTTTTTTTTTAGAGATAGGGTCTTGCTATGTTGCCCAGTTTTGTCTTGACTCCTGAGC
TCAAGAAGTCCTCATGCCTCAGCCTCTCAAAGTCCTGGGATTACAGGTGTGAGCCACCAT
GCCCAGCCAAGTTTAATTTTTTTGTTTGTTTGTTTTTGCTTTTGTTTTGTTTTTTGAGAC
AGGGTCTCACTCTGTTGGCCAGGATGCAGTGCAGTGGCACAATCACAGCTCACTGCAGCC
TTGACCTCCCAGGCCCAAGCAATTCGCCCACCTCAGCCTCCCAAGTTAGCTGGGACTACA
GGCGTGCACCACCACGCCTGGCTAATGTTTTGATTTTTCTGTAGAAATGGAGTTTCACTA
TGTTGTTCAGGCTCGTCTAGAACTCCCGGCCTCAAGCCATCCTCCCATCTCAGCCTCCCC
AAATCCTGGGATTATAGGCGTGAGCCACTGTGCCCAGCCAAGTTTCATTTCTGACCTATA
AACGTTATCATTATAGGTCCTTCTGCTTAAGAGATACGACCAAAGTGTACCTATTCATTC
ATTCCACAAATATTGTGTGCCAGGCCCCACACTGAGCTGAGTACTGTTCTAGGCACATGA
TATGTAACAGCAAGTAAAACATCCCTATCCTCACCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved