Pongo_pygmaeus Locus Mono:368:SNORA25
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:368:SNORA25
Pongo_pygmaeus
Mono:368:SNORA25
15_random
SNORA25
1001..1118
2118
TTTGAGACAGAGTCTTGCTCTGTCACCCAGGCTGGAGTGCACTGGCATGATCTTGGCTG
ACTGGAACCTCTACCTCTCAGGTTCAAGCGATTCTCCTGCCTTAGCCTCCGGAGTAGCTG
GGATTACAGGCGTGTGCCACCACGCCCAGCTAATTTTTGTATTTTTTAGTAGAGATGGGG
TTTCACTGCGTTGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAATGATCTACCCACCTCG
GCCTCCAGAAGTGCTGGAATTATAGGCATGAGCCACTGCACCCGGCCTGACTGAAGAATC
TTAATAAAAATGCTCTTCCAACTTCTCTGCAACCGGATATTAACAGACAAAACTGCCTTG
GTGCCAAGAAACAGCAATTAGTAATATATTAGAGCCTCTTTTTTATCTTTTGATATTCTA
GGATTCGAAAATGTTAATAAAGACATAAGATCTATAAATCTACAAAGAAGGTGCAGACTG
TGCATACAAGCCTGTTGCTGTTCACAAGACTCATGGAAATAGAACTTCTTGATTAAAGCT
ACCCTCACTCCTAACACACTCTCAGCCAGATCAATCCCTCAGTTCTGTTGAAACTACTAC
TTCATTATCTCAATATCCATTTCCTTCATCTCCACTGCCAACCGCCTAATCGGAGCTGCC
GACAATTCTGTCTTGCCTGGACTACTGTAAAGCCTCCTAACTGGTATCCATGACTCTAAT
CTTTGCCTCTGCTAAACGCTTTTCCTCACTGCAGCCCAAATGACCTTTCCAAAACACAAA
CCTGACTGTAACACTCCCCTCTTAAAAAACCTTTCAATGGCTTATCATCACTGACAGGAT
AAAGCCTAAAAGCCCTAGCTTCAAAGAGCAAAAAGTTTAATCACACAGTAGCCCCTTCTT
ATTCACGGTTTTGCTTTCCGTGGTTTCAGTTAACTGTGGCCAATCTTGGTCTGAAAATAT
TAAATGAAAAATTCCAGAAATAAACAATTGACAAATTTTATAGGTCATTTCAAAGAGGCT
GCAAAACCAAGAGCTCTTAACGCTGTGACCAAAGATGGAAGTTCTCTCTAGGATGCCATG
GCACTCGATGGTGGTATGTTTTCCTGGGGAGATATAAGACATAGGTGTTATATGACATAG
TAATCCATGATTGTTGCCATGGGAGAGTTTTAAAGATTAACCAAAGTAAAAAGAAAAAAC
AAATTGTAAACTTTGCACTGTTCTGAGCAGCATGATAAAATCTCATGCCACCCCACCTGG
GATGTGAAACAGCCCTTCATGCAGCATAGCCACAAGGTATACACTAGGCTGCCCGTTATC
CATTAAGTAGCTGTCTTGGTTACCAGATCAACTCTCCTGGTATCTCAGGGCTTGCGTGCA
AGTAACCACTATTTTACTTAATAAATGGCCCCAAAGCACGAGAAGTGATACCGGCATATT
ACTATAGTTGTTCTATTTTATGATTATTGTTGTTAATCTCTTACGGTGCCTAATTTATAA
ATTAAACTTCATAACAGGTGTGTATGTATAGGACAAAACACAATATATATAGGGTTTGGT
ACTATCTGCAGTGTCAGGCATCCGCTGGGGATCTGGGAAAGTATCTTCTGTGGATAAGGG
GGACTGCTGTACTCTCTTGGCCAGGGTTACAGGCATCGCACAGCCTCTACAGACGGCAAT
TTGGCATTATCTATTAAAACTAAAAATACTTATACTCTTTAACCCAAAAATTCCATTCCT
AGGAATTTATCGTACAGGTATACTTTCATGTGCAGATGGACTTATATACAAGGATATATA
CTGCAGCATTGTTTAAATTGCAATAGACTAGAAATCACCTAAATTCCAACAATACAGGGC
TGATCCAGTGAATTATGGTATATCCATATTCCAAATAAATAAAACAAATATCCAAATAAA
AAGGCAAGGTAAAGGATAGAAAGTATAATATGCAACCTTTGTGTGGAAAATACACAGACA
CACACATATTTTCAAAAGTAAAGAAAACAGCTCTGGAAGATGCCCAAAGAACCTGCTTTG
GCAACTGCCTTCAGGAAGAGGACCTAAGCAGTGGGGATAGGGAAGTGGGGAGACTTAATA
TTCTCTATATATCTTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved