Pongo_pygmaeus Locus Mono:104:SNORD60
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:104:SNORD60
Pongo_pygmaeus
Mono:104:SNORD60
10
SNORD60
1001..1075
2075
AACCTCAGATCTCATGAGAACTCACTATCACGAGAACAGCATGAGGGTAACCGCCCTGT
ACCATGTGATTAAATTACCTCCCACAACGCATGGGGATTATGGGAACTACAGTTTAAGAT
GAGATTTGGGTGGGGATACAGCCAAACCATATCACTTACATCACTGCTAATTGAACATTC
AAGCAGCATTTCTCCTTTGGGCATTTTATAGTTCACAAACATCTCTTCATGTAACATTAT
TCTATTATTTCATCTGAATTGGATTATTATTCTTTCCTGAAGTTTCAAGATGGATGTTGT
GGTCACTGGACACCTAGCAAGTCTACCTAATAATTCAAAAGAGGAAATTTAGGTCTAAGA
AAAATTTGAGAACATTGGAAGAAAGGGATCAAGGTTAATTTCAGGGGAGGTTTTGAATTG
ACTCCAGGAGAACTTATTTCAGCAAATGAATTTATCAGAGCGAATAATTATTGCATGGGT
AGCATGGGCTGGGTGGCACTCATTCATCAGTGGGTAAGGTACGGGCTGCTCTCTAAAGGA
ATTTATAGTTAGTGAAAAGACGGGGCATGTATGCCCATGGTTTTAATGAGCATGACAGAA
AAGCAGGAATCTGGGGAGGCTTCCTGACAGGTGGATTAGAGCTGGGCCTCAAATGGTTTC
AACAAATAGAGGTGGAAAGTGAGGAAGGGTACTCCAGGAAGAATCTGTGTGAGCAAAGGC
CTAGAGGTAGGGCAGTCCAGGGCCTGCTTGGGTAGTGGCAGATACTCCATTTATGAGGAA
ATATGCAGTCAATGTGAAGGGGAGTAGGAAATAAAGCTGCAAAAATGGCTGGGACAAGAC
TTACAAGGGGCTCAGATGCCAAGGGAAGGAGACTGAACTCTACAGAGAGCAATGTGAGAA
GTGGCTGTGGGGGCTGACAGTGGCTTTTGAATTTGGGAATTGTATGTTATAATTTAGGAA
GATGGACCAGGCAGTTGTGTTAGAAAAAATAGACACTTCAGAGGCTATGATGAATTGCTT
TAATTTCTGACACCTTGTATGAAAGCTGCACTTGCAGTCTTGCAAGACTGAGGCTTGGGG
GAGGAAAAAAAAAAGAAGAAAAAAGAGAGATCCTTGGGGTGGGAGGCAAGGCAGTTGGAA
GGTTAGTGTTTGGGAGAACTGCAATAATGGCTTGAACATGATTCACAGCAAAAATAATGA
AATAGTTTCCAGGGCTGGCAAAGAATGCAAGGGGGACTGCAGATAACTCCATGGTTGGGT
GGCTGGAAGGATGTTGGCTCGCCTGATAGAAATATAGAGTTCGAGGTAGAAGGCGGTGTG
AGGGGCATAAGCATCTCAGTGGGCTGATGGTGAGCAGGGGTGTCTGCTGGCACACACAGG
TTAGGACACACGGGAGACACTCCACACAGCAGTGAGCCAGGAGAGTTCACGCGCTGGAGT
TCTCTTCAGAGAGTGCTAGCCGGGGCCTAGGAGGTCGACATGGAGAGAGTGGGAAAGAGC
TGGGCCAAGGGACAGATCTCTACTTAGGAGGCCATGGGGGAAGGTAGAGATGAAGTCCAG
TTGAGAAATCTGGGAAGAGCGCCCAGAGAGGGGAGCACAGGGTGCTTCATGGGAAGGGGA
AGCACCAGGAAGGGGGTGGCTGGTTGGCAGGGTCAAAGACGGTGAGGGTGAAAGACCACC
TGATGAGGAGGTGAGAAGGTCAGTGGGGGCCTTGAGGAAGCAGTTCTGGTGCGAGGCTAT
CCAGAGACTGAGGAGGCAGAATGTTTAGACCATGGAACACGCACCTAAGGGATGGGGAAA
GGAAGGGGAGACTCAGCTTGCAAAGGTGGCATTGCAGAGGTTTGACTTTCTGTGCGGGGG
GTGTCTAAGTGTGTCTGTGGCTTGAAGACAGGGAAGTAGTGAAAGAGAAAATATGCAAGA
GAGGGAGAGCCACGACCGAGCAGAATGTAAAAGCAGGTGAGAAAAGATGCCAAGGGCCGT
GTCTTCCTAGATGGGGAGAGAAATGAAGACACCAGACACCATTTCCGTAGATGCCCTCTC
TGTTGTCCCAAACATCACCAGATGCCACAGATGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved